Prev. |  KEGG KO K06535 > 

RIKEN DNA Bank Human Resource - BSG

Gene ID NCBI Gene 682 |  KEGG hsa:682
Gene Symbol BSG
Protein Name basigin (Ok blood group)
Synonyms 5F7|CD147|EMMPRIN|OK|TCSF
Ortholog resources KEGG ortholog (KEGG orthology K06535) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005347 IRAK013G03 pCMV-SPORT6 BC009040 NM_198590 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014341 W01A035O05 pENTR-TOPO IRAK013G03 BC009040 NM_198590  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045323 ARe13F03 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR047330 ARe18F10 pKA1U5 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
HKR049307 ARe23E11 pKA1U5 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGNAATNATGGCGGCTGCGCTGTTCGTGCT
HKR054550 ARe36G06 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR070876 ARe77D04 pKA1U5 NM_001728.2  
GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGCNATNTTGTAGGACCGGCGAGGAATAG
HKR074923 ARe87F03 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR079657 ARe99C09 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR082079 ARf05D07 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR162979 ARi07H11 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR178836 ARi47B12 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR179369 ARi48H01 pGCAP10 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
HKR187769 ARi69H01 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR203292 ARiS008D20 pGCAP10 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
HKR260031 ARiS150B07 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR260293 ARiS150M05 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR279526 ARiS198N14 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR279565 ARiS198P05 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR322028 RBb05B04 pKA1U5 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR322108 RBb05E12 pKA1U5 NM_001728.2  
GGCTTTTTATAGCGGCCGCGGGCGGCGGCGGCCCNTTTTGGAGGTTGTAGGACCGGCGAG
HKR338453 RBb46C05 pGCAP1 NM_001728.2  
TGGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGTCTTGCTGCGCTGTTCGT
HKR340077 RBb50D05 pGCAP1 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR366552 RBd16G08 pGCAP10 NM_001728.2  
GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGG
HKR373626 RBd34B02 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR378171 RBd45H03 pGCAP10 NM_001728.2  
GGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTG
HKR383725 RBd59F05 pGCAP10 NM_001728.2  
GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGG
HKR384456 RBd61C08 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR397679 RBd94D07 pGCAP10 NM_001728.2  
GGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTG
HKR397771 RBd94H03 pGCAP10 NM_001728.2  
CGGCCGGCCGATGATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCG
HKR405541 RBdS013O05 pGCAP10 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
HKR406005 RBdS015A05 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR433366 RBdS083G22 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR433403 RBdS083I11 pGCAP10 NM_001728.2  
GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
HKR442053 RBdS105C05 pGCAP10 NM_001728.2  
TTGGGGTGGCGTGCGCGCGCCCGGTCCGCGCCTCCGCCGCTTTTTATAGCGGCCGCGGGC
HKR442284 RBdS105L20 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR444222 RBdS110J06 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
HKR474993 RBdS187I01 pGCAP10 NM_001728.2  
GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl