Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00363

HP ID(1) HP00363
Gene ID(2) 6222
Gene Symbol finder RPS18
Protein Name ribosomal protein S18
RefSeq NM_022551.2
Length of RefSeq (bp) 549
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.627414

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07C09 pKA1U5 ATGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
ARe07F06 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe08H03 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe11C11 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe12B09 pKA1U5 TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARe12H11 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe15A01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe16A12 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe17G12 pKA1U5 GCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTG
ARe18E01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGCTGCTGCAGCCATGTCTCTAGTGATC
ARe19F01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGNTGCAGCCATGTCTCTAGTGATCC
ARe25F10 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe35D07 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
ARe40D04 pKA1U5 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
ARe42A07 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe43A12 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe45F04 pKA1U5 ATCCTGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAG
ARe51E04 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe53E05 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGCTGCTGCAGCCATGNTCTCTAGTGAT
ARe53E11 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGATCTCTAGTTGA
ARe58F02 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe61A10 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGNTGCAGCCATGTCTCTAGTGATCC
ARe61G12 pKA1U5 GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTCCCTTTTGNAGCCATGTCTCTAGATGA
ARe66D05 pKA1U5 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGTCTCTAGTGA
ARe69A06 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe73E03 pKA1U5 TTGTGCTCTTCCACAGGAGGCCTACACGCCGCCCCCTTGTGCTGCAGCCATGTCTCTAGT
ARe79C05 pKA1U5 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATCCC
ARe82D06 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe84G06 pKA1U5 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARe85C05 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe87D04 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe91F11 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe91G04 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe95D01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe96B10 pKA1U5 GCGCTCTTCCCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
ARe98E09 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe99A01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARe99H12 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARf03C08 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARf04E05 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
ARf04H01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARf07B03 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi05A07 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARi14B02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi17G07 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi19C06 pGCAP10 TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARi21E03 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi26D09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi28F06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi31H03 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi37B12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi41A05 pGCAP10 TGCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
ARi41B12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi41D05 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi41D06 pGCAP10 GACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAA
ARi43E03 pGCAP10 GACTTCCGCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTC
ARi43G11 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi43G12 pGCAP10 GCTCTTCTTCCCGANGCCTATTCNTTCNCCGCTTGTGCTGCAGCCCTGTCTCTATGGAAC
ARi50A05 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi51G05 pGCAP10 CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi53A09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi55G11 pGCAP10 CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi57A03 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARi69D06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS008D23 pGCAP10 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
ARiS008I08 pGCAP10 GCTCTTCCACAGGANGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS013C19 pGCAP10 GCTTCTCTTCCACANGNNGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
ARiS013E21 pGCAP10 GCTTCCNCNNGAGGCCNACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
ARiS013I22 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS020M07 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS045B18 pGCAP10 GCTCTTCCACAGGNNGCCTACNCTCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS045J09 pGCAP10 TGCTCTTCCACNGGANGCCTACACCCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
ARiS045O21 pGCAP10 CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS049A12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS049H11 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARiS055A12 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARiS055L04 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS088C06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS088I05 pGCAP10 GCTCNNCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS109D02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS109K16 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARiS109M16 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
ARiS118E05 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS118E12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS122K08 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
ARiS150H06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS161A06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS191D13 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
ARiS194G15 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb01D03 pKA1U5
RBb03B04 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb04D07 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb05B03 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb06A07 pKA1U5 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATCCC
RBb07F02 pKA1U5 ATCCTGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGT
RBb09B09 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb12C05 pKA1U5 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBb14D08 pKA1U5 GTGGCGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGTCTCTA
RBb15H01 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb18D05 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb18H02 pKA1U5 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb23A01 pGCAP1 GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGAT
RBb25C11 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb28G11 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb31H02 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCCGCCCGCTTTGTGCTGCAGCCATGNTCTCTAGTG
RBb32C07 pGCAP1 GAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCC
RBb33H05 pGCAP1 GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCNATGNTCTCTAGTGAT
RBb34C09 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb34F01 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb37D08 pGCAP1 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBb37G06 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb40C02 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb40C05 pGCAP1 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBb44F12 pGCAP1 TGGCTCCTCCCACAGNGCAGGCCCTACACGTCCGACCGANNTTGTTGCTGCCTCCNTT
RBb47E10 pGCAP1 CCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGATCTCTAGTGATCC
RBb48D07 pGCAP1 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGNTCTCTAGTGA
RBb48G05 pGCAP1 TCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb49H10 pGCAP1 AAGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBb50E01 pGCAP1 GCTCTTCCACAGGNAGGCCTACACNCCGCCGCNTTGGTGCTGCAGCCATGATCTCTAGTG
RBb52F02 pGCAP1 GCTCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGTCTCTAGTG
RBb55C10 pGCAP1 GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBb57F07 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
RBb60B11 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb63A05 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb68G09 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBb71H06 pGCAP1 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd02G11 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd04A07 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd04G07 pGCAP10 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBd10A10 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd10E06 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd10F03 pGCAP10 CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd11B02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd14D06 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBd16H11 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd17E11 pGCAP10 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBd19G11 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd19H11 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBd22A02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd30G11 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd30H03 pGCAP10 GCTCTTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
RBd31B01 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd32E07 pGCAP10
RBd43A04 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd44D02 pGCAP10 GTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCC
RBd44F01 pGCAP10 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBd47B11 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBd48A11 pGCAP10 GGCTCTTCCGCGGGAGGCCTACTCGCGNCCGCTTGTGCTGCANCCNTGTCTCTAGAGGTC
RBd48B12 pGCAP10 TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBd48G02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd50H05 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBd51A03 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBd53B09 pGCAP10 GCTCTTCCNCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd53F12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd58F08 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd66H03 pGCAP10 GCTCTTCNNCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd67G09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd70F04 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBd71D12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd74F10 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd75D10 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd78D01 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd80B02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd80D05 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd89D01 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd91H02 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBd94F08 pGCAP10 GGTCACTTCCGCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCAT
RBd99H01 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBdS007I19 pGCAP10 GAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCC
RBdS007J18 pGCAP10 CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS007P17 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS013F14 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS013J05 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS014L12 pGCAP10 CGGCCGGCCGATGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGT
RBdS014P03 pGCAP10 GNTCNACCGNNNNNNCGNNCNCGCCGANNNNNGNGNNNCNNCCATGTNNCTAGNGNNNCN
RBdS015C13 pGCAP10 TGAATCCACGCCAGTACAAGATCCCAGACTGGTTCTTGAACAGACAGAAGGATGTAAAGG
RBdS015E21 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS015H04 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS015L01 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS022E09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS022F07 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS040M15 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS070H19 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS075C19 pGCAP10 TTGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS075L19 pGCAP10 TGCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCC
RBdS081I12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS081I16 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS081I24 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS083F13 pGCAP10 GCTCTTCCNCANGAGGCCTACACGCCGCCGCTTGTGCTGCANCCATGTCTCTAGTGATCC
RBdS083G12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS083O15 pGCAP10 GACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAA
RBdS104H14 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS104P10 pGCAP10 GGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCCAGCATATTTTGCG
RBdS105B19 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS105K20 pGCAP10 CCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS110C01 pGCAP10 TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS110D18 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBdS132A17 pGCAP10 GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
RBdS132L17 pGCAP10 GTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBdS154A23 pGCAP10 GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
RBdS154G12 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS154N09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS156A02 pGCAP10 GCTCTTCCNCNNGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCNTGTCTCTAGNGNTCC
RBdS156B01 pGCAP10 AGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
RBdS177A09 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS177J08 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS187D10 pGCAP10 GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
RBdS187H03 pGCAP10 CTGCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl