Prev. |  KEGG KO K02964 > 

RIKEN DNA Bank Human Resource - RPS18

Gene ID NCBI Gene 6222 |  KEGG hsa:6222
Gene Symbol RPS18
Protein Name ribosomal protein S18
Synonyms D6S218E|HKE3|KE-3|KE3|S18
Ortholog resources KEGG ortholog (KEGG orthology K02964) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103071 IRAL057L07 pDNR-LIB BC070230 NM_022551.3 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042857 ARe07C09 pKA1U5 NM_022551.2  
ATGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
HKR042926 ARe07F06 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR043371 ARe08H03 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR044459 ARe11C11 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR044833 ARe12B09 pKA1U5 NM_022551.2  
TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR044979 ARe12H11 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR046001 ARe15A01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR046412 ARe16A12 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR046956 ARe17G12 pKA1U5 NM_022551.2  
GCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTG
HKR047297 ARe18E01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGCTGCTGCAGCCATGTCTCTAGTGATC
HKR047721 ARe19F01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGNTGCAGCCATGTCTCTAGTGATCC
HKR050130 ARe25F10 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR054079 ARe35D07 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
HKR056076 ARe40D04 pKA1U5 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR056807 ARe42A07 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR057212 ARe43A12 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR058124 ARe45F04 pKA1U5 NM_022551.2  
ATCCTGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAG
HKR060500 ARe51E04 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR061301 ARe53E05 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGCTGCTGCAGCCATGNTCTCTAGTGAT
HKR061307 ARe53E11 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGATCTCTAGTTGA
HKR063322 ARe58F02 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR064410 ARe61A10 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGNTGCAGCCATGTCTCTAGTGATCC
HKR064556 ARe61G12 pKA1U5 NM_022551.2  
GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTCCCTTTTGNAGCCATGTCTCTAGATGA
HKR066477 ARe66D05 pKA1U5 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGTCTCTAGTGA
HKR067606 ARe69A06 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR069299 ARe73E03 pKA1U5 NM_022551.2  
TTGTGCTCTTCCACAGGAGGCCTACACGCCGCCCCCTTGTGCTGCAGCCATGTCTCTAGT
HKR071653 ARe79C05 pKA1U5 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATCCC
HKR072878 ARe82D06 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR073750 ARe84G06 pKA1U5 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR074053 ARe85C05 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR074876 ARe87D04 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR076531 ARe91F11 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR076548 ARe91G04 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR078073 ARe95D01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR078434 ARe96B10 pKA1U5 NM_022551.2  
GCGCTCTTCCCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR079305 ARe98E09 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR079601 ARe99A01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR079780 ARe99H12 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR081256 ARf03C08 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR081701 ARf04E05 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
HKR081769 ARf04H01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR082827 ARf07B03 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR162007 ARi05A07 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR165626 ARi14B02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR166951 ARi17G07 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR167654 ARi19C06 pGCAP10 NM_022551.2  
TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR168499 ARi21E03 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR170481 ARi26D09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR171326 ARi28F06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR172571 ARi31H03 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR174836 ARi37B12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR176405 ARi41A05 pGCAP10 NM_022551.2  
TGCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
HKR176436 ARi41B12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR176477 ARi41D05 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR176478 ARi41D06 pGCAP10 NM_022551.2  
GACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAA
HKR177299 ARi43E03 pGCAP10 NM_022551.2  
GACTTCCGCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTC
HKR177355 ARi43G11 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR177356 ARi43G12 pGCAP10 NM_022551.2  
GCTCTTCTTCCCGANGCCTATTCNTTCNCCGCTTGTGCTGCAGCCCTGTCTCTATGGAAC
HKR180005 ARi50A05 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR180549 ARi51G05 pGCAP10 NM_022551.2  
CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR181209 ARi53A09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR182155 ARi55G11 pGCAP10 NM_022551.2  
CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR182803 ARi57A03 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR187678 ARi69D06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR203295 ARiS008D23 pGCAP10 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR203400 ARiS008I08 pGCAP10 NM_022551.2  
GCTCTTCCACAGGANGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR205267 ARiS013C19 pGCAP10 NM_022551.2  
GCTTCTCTTCCACANGNNGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
HKR205317 ARiS013E21 pGCAP10 NM_022551.2  
GCTTCCNCNNGAGGCCNACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR205414 ARiS013I22 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR208295 ARiS020M07 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR218042 ARiS045B18 pGCAP10 NM_022551.2  
GCTCTTCCACAGGNNGCCTACNCTCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR218225 ARiS045J09 pGCAP10 NM_022551.2  
TGCTCTTCCACNGGANGCCTACACCCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR218357 ARiS045O21 pGCAP10 NM_022551.2  
CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR219612 ARiS049A12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR219779 ARiS049H11 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR222012 ARiS055A12 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR222268 ARiS055L04 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR235254 ARiS088C06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR235397 ARiS088I05 pGCAP10 NM_022551.2  
GCTCNNCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR243674 ARiS109D02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR243856 ARiS109K16 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR243904 ARiS109M16 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR247301 ARiS118E05 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR247308 ARiS118E12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR249048 ARiS122K08 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR260174 ARiS150H06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR264406 ARiS161A06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR276485 ARiS191D13 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR277759 ARiS194G15 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR320475 RBb01D03 pKA1U5 NM_022551.2  
HKR321228 RBb03B04 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR321679 RBb04D07 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR322027 RBb05B03 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR322407 RBb06A07 pKA1U5 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATCCC
HKR322922 RBb07F02 pKA1U5 NM_022551.2  
ATCCTGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGT
HKR323633 RBb09B09 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR324853 RBb12C05 pKA1U5 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR325680 RBb14D08 pKA1U5 NM_022551.2  
GTGGCGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGTCTCTA
HKR326169 RBb15H01 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR327277 RBb18D05 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR327370 RBb18H02 pKA1U5 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR329201 RBb23A01 pGCAP1 NM_022551.2  
GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGAT
HKR330059 RBb25C11 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR331355 RBb28G11 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR332570 RBb31H02 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCCGCCCGCTTTGTGCTGCAGCCATGNTCTCTAGTG
HKR332855 RBb32C07 pGCAP1 NM_022551.2  
GAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCC
HKR333373 RBb33H05 pGCAP1 NM_022551.2  
GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCNATGNTCTCTAGTGAT
HKR333657 RBb34C09 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR333721 RBb34F01 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR334880 RBb37D08 pGCAP1 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR334950 RBb37G06 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR336050 RBb40C02 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR336053 RBb40C05 pGCAP1 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR337732 RBb44F12 pGCAP1 NM_022551.2  
TGGCTCCTCCCACAGNGCAGGCCCTACACGTCCGACCGANNTTGTTGCTGCCTCCNTT
HKR338906 RBb47E10 pGCAP1 NM_022551.2  
CCTTCCACAGGAGGCCTACACGCCGCCGCTTGTTGCTGCAGCCATGATCTCTAGTGATCC
HKR339279 RBb48D07 pGCAP1 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGNTCTCTAGTGA
HKR339349 RBb48G05 pGCAP1 NM_022551.2  
TCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR339778 RBb49H10 pGCAP1 NM_022551.2  
AAGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR340097 RBb50E01 pGCAP1 NM_022551.2  
GCTCTTCCACAGGNAGGCCTACACNCCGCCGCNTTGGTGCTGCAGCCATGATCTCTAGTG
HKR340922 RBb52F02 pGCAP1 NM_022551.2  
GCTCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTTGTGCTGCAGCCATGTCTCTAGTG
HKR342058 RBb55C10 pGCAP1 NM_022551.2  
GCTCTTCCACAGGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR342927 RBb57F07 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGNTCTCTAGTGATC
HKR344035 RBb60B11 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR345205 RBb63A05 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR347353 RBb68G09 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR348574 RBb71H06 pGCAP1 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR360955 RBd02G11 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR361607 RBd04A07 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR361751 RBd04G07 pGCAP10 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR364010 RBd10A10 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR364102 RBd10E06 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR364123 RBd10F03 pGCAP10 NM_022551.2  
CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR364426 RBd11B02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR365678 RBd14D06 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR366579 RBd16H11 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR366907 RBd17E11 pGCAP10 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR367755 RBd19G11 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR367779 RBd19H11 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR368802 RBd22A02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR372155 RBd30G11 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR372171 RBd30H03 pGCAP10 NM_022551.2  
GCTCTTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGA
HKR372425 RBd31B01 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR372903 RBd32E07 pGCAP10 NM_022551.2  
HKR377204 RBd43A04 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR377674 RBd44D02 pGCAP10 NM_022551.2  
GTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCC
HKR377721 RBd44F01 pGCAP10 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR378835 RBd47B11 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR379236 RBd48B12 pGCAP10 NM_022551.2  
TGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR379346 RBd48G02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR380173 RBd50H05 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR380403 RBd51A03 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR381233 RBd53B09 pGCAP10 NM_022551.2  
GCTCTTCCNCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR381332 RBd53F12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR383328 RBd58F08 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR386571 RBd66H03 pGCAP10 NM_022551.2  
GCTCTTCNNCAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR386953 RBd67G09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR388124 RBd70F04 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR388484 RBd71D12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR389730 RBd74F10 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR390082 RBd75D10 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR391273 RBd78D01 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR392026 RBd80B02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR392077 RBd80D05 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR395673 RBd89D01 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR396570 RBd91H02 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR397728 RBd94F08 pGCAP10 NM_022551.2  
GGTCACTTCCGCTCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCAT
HKR399769 RBd99H01 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR403011 RBdS007I19 pGCAP10 NM_022551.2  
GAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCC
HKR403034 RBdS007J18 pGCAP10 NM_022551.2  
CCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR403177 RBdS007P17 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR405334 RBdS013F14 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR405421 RBdS013J05 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR405876 RBdS014L12 pGCAP10 NM_022551.2  
CGGCCGGCCGATGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGT
HKR405963 RBdS014P03 pGCAP10 NM_022551.2  
GNTCNACCGNNNNNNCGNNCNCGCCGANNNNNGNGNNNCNNCCATGTNNCTAGNGNNNCN
HKR406061 RBdS015C13 pGCAP10 NM_022551.2  
TGAATCCACGCCAGTACAAGATCCCAGACTGGTTCTTGAACAGACAGAAGGATGTAAAGG
HKR406117 RBdS015E21 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR406172 RBdS015H04 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR406265 RBdS015L01 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR408905 RBdS022E09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR408927 RBdS022F07 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR416303 RBdS040M15 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR428187 RBdS070H19 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR430067 RBdS075C19 pGCAP10 NM_022551.2  
TTGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR430283 RBdS075L19 pGCAP10 NM_022551.2  
TGCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCC
HKR432604 RBdS081I12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR432608 RBdS081I16 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR432616 RBdS081I24 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR433333 RBdS083F13 pGCAP10 NM_022551.2  
GCTCTTCCNCANGAGGCCTACACGCCGCCGCTTGTGCTGCANCCATGTCTCTAGTGATCC
HKR433356 RBdS083G12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR433551 RBdS083O15 pGCAP10 NM_022551.2  
GACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAA
HKR441782 RBdS104H14 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR441970 RBdS104P10 pGCAP10 NM_022551.2  
GGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCTGAAAAGTTCCAGCATATTTTGCG
HKR442043 RBdS105B19 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR442260 RBdS105K20 pGCAP10 NM_022551.2  
CCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR444049 RBdS110C01 pGCAP10 NM_022551.2  
TGGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR444090 RBdS110D18 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR452817 RBdS132A17 pGCAP10 NM_022551.2  
GCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCCCT
HKR453081 RBdS132L17 pGCAP10 NM_022551.2  
GTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR461623 RBdS154A23 pGCAP10 NM_022551.2  
GCTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGAT
HKR461756 RBdS154G12 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR461921 RBdS154N09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR462402 RBdS156A02 pGCAP10 NM_022551.2  
GCTCTTCCNCNNGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCNTGTCTCTAGNGNTCC
HKR462425 RBdS156B01 pGCAP10 NM_022551.2  
AGCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATC
HKR470809 RBdS177A09 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR471024 RBdS177J08 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR474882 RBdS187D10 pGCAP10 NM_022551.2  
GCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC
HKR474971 RBdS187H03 pGCAP10 NM_022551.2  
CTGCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCCATGTCTCTAGTGATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl