Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00347

HP ID(1) HP00347
Gene ID(2) 6164
Gene Symbol finder RPL34
Protein Name ribosomal protein L34
RefSeq NM_000995.3
Length of RefSeq (bp) 918
Chromosome 4q25
Reference DDBJ accession
UniGene Hs.438227

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19B09 pKA1U5 TTTGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
ARe21E12 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe22E02 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe41D10 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe49D08 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe50C03 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe56H06 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCACCATGGTCCAGCGTTTGACATACCGACG
ARe57C10 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe61E10 pKA1U5 GCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACCCNTAATGGTCCAGCGTTTGACATACC
ARe61G10 pKA1U5 GATATCGCCANGGGAGGNAGGAACGGCAGGCCCCCCTTNAAGGTCCNGCGGTTNGACATA
ARe63B03 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe63B12 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe65E02 pKA1U5 GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
ARe68F10 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe83G12 pKA1U5 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARe84G11 pKA1U5 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARe88B06 pKA1U5 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARe88H01 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARe94D12 pKA1U5 GTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
ARe94H04 pKA1U5 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARe98G03 pKA1U5 GGCTTTTTTCTTCCTCTTCCGGGGACGTTGTCTGCNGGCACTCAGAATGGTCCAGCGATT
ARe99D04 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARf02F01 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi14B08 pGCAP10 CCGCTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACA
ARi16G03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi17A09 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi24H05 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi33G05 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi43B06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi44E01 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi46C07 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi51H09 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi53B08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi61A02 pGCAP10 CCGCTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACA
ARi65F05 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARi71D10 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCCCGCACTCATAATGGTCCAGCGTTTGACATACCGACG
ARiS008J16 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS020K04 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS020O18 pGCAP10 GTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
ARiS023G08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS023L12 pGCAP10 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARiS049A21 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS049F04 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS055E04 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS088J21 pGCAP10 AGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTGCCATCCG
ARiS096B08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS109O03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS150J07 pGCAP10 GCTCTTCCGGGGACNTTNTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS161D24 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
ARiS191A11 pGCAP10 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
ARiS198B12 pGCAP10 TGGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCT
ARiS198I08 pGCAP10 TGGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCT
RBb01F12 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCACCAATGGTCCAGCGTTTGACATACCGAC
RBb02A01 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb08C04 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb12A09 pKA1U5 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb15B06 pKA1U5 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCANAATGGTCCAGCGTTTGACATACCGAC
RBb24G07 pGCAP1 TTGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
RBb25H03 pGCAP1 GGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTG
RBb27A10 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb27H12 pGCAP1 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
RBb28C11 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb31D08 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTTGACATACCGAC
RBb39D12 pGCAP1
RBb41E06 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb45F04 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb53F01 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTTGACATACCGAC
RBb56G06 pGCAP1 GGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTT
RBb57D05 pGCAP1 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
RBb62E01 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBb66C05 pGCAP1 GCTCTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
RBb66G09 pGCAP1 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd05A01 pGCAP10
RBd05A04 pGCAP10
RBd07D06 pGCAP10 GCTCTTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
RBd10B03 pGCAP10 TGGCTCTTCCGGGGACGTTGTCTGCAAGCTCTCCAAATGGTCCCCCGTTTGACATACGGA
RBd16B10 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd18H08 pGCAP10 GCTCTTCCGGGGACGGTGGCTGCGCGCACTCNGAATGGTCCAGCGTTTGACATACCGACN
RBd21A08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd21C06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd23G07 pGCAP10 TGGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTGCCA
RBd24F10 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd25A03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd25C03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd36D06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd42E03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd45D12 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd55D01 pGCAP10 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCANCGTTTGACATACCGAC
RBd57A09 pGCAP10 GNTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd57C06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd64E01 pGCAP10 GCTCTNNCNNGGGGNACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
RBd75B03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd76F08 pGCAP10 GCTCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
RBd77D05 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd82C05 pGCAP10 GGTCTTTATTTCCTTACCAATCGGCTGCCATCCGAGGAGCTGAGGAAGCCTAGAGCTCTC
RBd84D06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBd85B02 pGCAP10 GGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTG
RBd97C06 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS014J09 pGCAP10 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
RBdS015A19 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS022B22 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS040D21 pGCAP10 GCTCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
RBdS040O03 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS070C22 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS070E16 pGCAP10 GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
RBdS070K23 pGCAP10 TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
RBdS075E08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS075K08 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS075O24 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS083H15 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS104E10 pGCAP10 GGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTT
RBdS105E05 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS132F17 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS132F19 pGCAP10 GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
RBdS154L02 pGCAP10 GGACGTTGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAAT
RBdS154J10 pGCAP10 CGGCCGGCCGATGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl