Prev. |  KEGG KO K02915 > 

RIKEN DNA Bank Human Resource - RPL34

Gene ID NCBI Gene 6164 |  KEGG hsa:6164
Gene Symbol RPL34
Protein Name ribosomal protein L34
Synonyms L34
Ortholog resources KEGG ortholog (KEGG orthology K02915) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082733 IRAL006N21 pOTB7 BC001773 NM_033625 Full
HGY103109 IRAL057M21 pDNR-LIB BC070208 NM_033625 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047633 ARe19B09 pKA1U5 NM_000995.3  
TTTGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
HKR048508 ARe21E12 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR048898 ARe22E02 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR056482 ARe41D10 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR059680 ARe49D08 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR060051 ARe50C03 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR062574 ARe56H06 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCACCATGGTCCAGCGTTTGACATACCGACG
HKR062858 ARe57C10 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR064506 ARe61E10 pKA1U5 NM_000995.3  
GCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACCCNTAATGGTCCAGCGTTTGACATACC
HKR064554 ARe61G10 pKA1U5 NM_000995.3  
GATATCGCCANGGGAGGNAGGAACGGCAGGCCCCCCTTNAAGGTCCNGCGGTTNGACATA
HKR065227 ARe63B03 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR065236 ARe63B12 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR066098 ARe65E02 pKA1U5 NM_000995.3  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR067330 ARe68F10 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR073356 ARe83G12 pKA1U5 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR073755 ARe84G11 pKA1U5 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR075230 ARe88B06 pKA1U5 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR075369 ARe88H01 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR077684 ARe94D12 pKA1U5 NM_000995.3  
GTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
HKR077772 ARe94H04 pKA1U5 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR079347 ARe98G03 pKA1U5 NM_000995.3  
GGCTTTTTTCTTCCTCTTCCGGGGACGTTGTCTGCNGGCACTCAGAATGGTCCAGCGATT
HKR079676 ARe99D04 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR080921 ARf02F01 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR165632 ARi14B08 pGCAP10 NM_000995.3  
CCGCTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACA
HKR166547 ARi16G03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR166809 ARi17A09 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR169773 ARi24H05 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR173349 ARi33G05 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR177230 ARi43B06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR177697 ARi44E01 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR178455 ARi46C07 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR180577 ARi51H09 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR181232 ARi53B08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR184402 ARi61A02 pGCAP10 NM_000995.3  
CCGCTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACA
HKR186125 ARi65F05 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR188482 ARi71D10 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCCCGCACTCATAATGGTCCAGCGTTTGACATACCGACG
HKR203432 ARiS008J16 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR208244 ARiS020K04 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR208354 ARiS020O18 pGCAP10 NM_000995.3  
GTCTTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
HKR209352 ARiS023G08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR209476 ARiS023L12 pGCAP10 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR219621 ARiS049A21 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR219724 ARiS049F04 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR222100 ARiS055E04 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR235437 ARiS088J21 pGCAP10 NM_000995.3  
AGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTGCCATCCG
HKR238432 ARiS096B08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR243939 ARiS109O03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR260223 ARiS150J07 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACNTTNTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR264496 ARiS161D24 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR276411 ARiS191A11 pGCAP10 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR279236 ARiS198B12 pGCAP10 NM_000995.3  
TGGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCT
HKR279400 ARiS198I08 pGCAP10 NM_000995.3  
TGGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCT
HKR320532 RBb01F12 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCACCAATGGTCCAGCGTTTGACATACCGAC
HKR320801 RBb02A01 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR323252 RBb08C04 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR324809 RBb12A09 pKA1U5 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR326030 RBb15B06 pKA1U5 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCANAATGGTCCAGCGTTTGACATACCGAC
HKR329751 RBb24G07 pGCAP1 NM_000995.3  
TTGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
HKR330171 RBb25H03 pGCAP1 NM_000995.3  
GGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTG
HKR330810 RBb27A10 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR330980 RBb27H12 pGCAP1 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR331259 RBb28C11 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR332480 RBb31D08 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTTGACATACCGAC
HKR335684 RBb39D12 pGCAP1 NM_000995.3  
HKR336502 RBb41E06 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR338124 RBb45F04 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR341321 RBb53F01 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTTGACATACCGAC
HKR342550 RBb56G06 pGCAP1 NM_000995.3  
GGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTT
HKR342877 RBb57D05 pGCAP1 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR344897 RBb62E01 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR346453 RBb66C05 pGCAP1 NM_000995.3  
GCTCTCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATAC
HKR346553 RBb66G09 pGCAP1 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR362001 RBd05A01 pGCAP10 NM_000995.3  
HKR362004 RBd05A04 pGCAP10 NM_000995.3  
HKR362878 RBd07D06 pGCAP10 NM_000995.3  
GCTCTTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
HKR364027 RBd10B03 pGCAP10 NM_000995.3  
TGGCTCTTCCGGGGACGTTGTCTGCAAGCTCTCCAAATGGTCCCCCGTTTGACATACGGA
HKR366434 RBd16B10 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR367376 RBd18H08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGGTGGCTGCGCGCACTCNGAATGGTCCAGCGTTTGACATACCGACN
HKR368408 RBd21A08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR368454 RBd21C06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR369351 RBd23G07 pGCAP10 NM_000995.3  
TGGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTGCCA
HKR369730 RBd24F10 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR370003 RBd25A03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR370051 RBd25C03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR374478 RBd36D06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR376899 RBd42E03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR378084 RBd45D12 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR382073 RBd55D01 pGCAP10 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCANCGTTTGACATACCGAC
HKR382809 RBd57A09 pGCAP10 NM_000995.3  
GNTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR382854 RBd57C06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR385697 RBd64E01 pGCAP10 NM_000995.3  
GCTCTNNCNNGGGGNACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCG
HKR390027 RBd75B03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR390528 RBd76F08 pGCAP10 NM_000995.3  
GCTCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
HKR390877 RBd77D05 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR392853 RBd82C05 pGCAP10 NM_000995.3  
GGTCTTTATTTCCTTACCAATCGGCTGCCATCCGAGGAGCTGAGGAAGCCTAGAGCTCTC
HKR393678 RBd84D06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR394026 RBd85B02 pGCAP10 NM_000995.3  
GGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAATCGGCTG
HKR398854 RBd97C06 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR405825 RBdS014J09 pGCAP10 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR406019 RBdS015A19 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR408846 RBdS022B22 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR416093 RBdS040D21 pGCAP10 NM_000995.3  
GCTCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGA
HKR416339 RBdS040O03 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR428070 RBdS070C22 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR428112 RBdS070E16 pGCAP10 NM_000995.3  
GCCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR428263 RBdS070K23 pGCAP10 NM_000995.3  
TGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGAC
HKR430104 RBdS075E08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR430248 RBdS075K08 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR430360 RBdS075O24 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR433383 RBdS083H15 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR441706 RBdS104E10 pGCAP10 NM_000995.3  
GGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTT
HKR442101 RBdS105E05 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR452937 RBdS132F17 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR452939 RBdS132F19 pGCAP10 NM_000995.3  
GCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACG
HKR461826 RBdS154J10 pGCAP10 NM_000995.3  
CGGCCGGCCGATGCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTT
HKR461866 RBdS154L02 pGCAP10 NM_000995.3  
GGACGTTGTCTGCAGGTATGGATGTTGTTCTCTTTTCCCTGTCTTTATTTCCTTACCAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl