Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00323

HP ID(1) HP00323
Gene ID(2) 6201
Gene Symbol finder RPS7
Protein Name ribosomal protein S7
RefSeq NM_001011.2
Length of RefSeq (bp) 729
Chromosome 2p25
Reference DDBJ accession
UniGene Hs.546287

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02E02 pKA1U5 GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGG
ARe04H08 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
ARe11G05 pKA1U5 GTCTTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
ARe12F07 pKA1U5 TGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
ARe14F03 pKA1U5 GGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGATTCTCCCAGGAGAAAGCCATG
ARe15E02 pKA1U5 TGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
ARe24F04 pKA1U5 ATCCTGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGT
ARe27C01 pKA1U5 GCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCGC
ARe31C01 pKA1U5 TGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
ARe32E12 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe33C08 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe37D07 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe38F08 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
ARe39B07 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe40E05 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
ARe52H10 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCNNNTAAAAAGCCATGTTCAGTTCGAG
ARe54B09 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe56H10 pKA1U5 TGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCCCCNTNNAGAAAGCCATGTTCAGTTCGA
ARe72H02 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe76E02 pKA1U5 GGGACGCCGGATTTTGACGTGCTCTCGCGAGACTTTNGTCTCTTCCTAAGCCGGCGCTCG
ARe76H11 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCCTTAGAAAGCCATGTTCAGTTCGAGC
ARe82H06 pKA1U5 GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
ARe84E09 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe87D01 pKA1U5 GGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAA
ARe89E03 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe90A12 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe90B10 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe93A03 pKA1U5 GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGG
ARe94F03 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARe96E06 pKA1U5 GTCGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCC
ARi05C01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAGGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi07G11 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi16C07 pGCAP10 GGACAAGAACTTGAAGCCTATCAAGCCCATGCAGTTTCTGGGGGATGAAGAGACGGTGCG
ARi17E09 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi19E01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi21H03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi23H04 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi27C07 pGCAP10 GTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCG
ARi27E01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi39D03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi39F12 pGCAP10 TGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
ARi41C07 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi46C01 pGCAP10 GCTCTTCCCCCCCCGGCGCTCAGAGAGATCGCCCAGGAGAAATCCATGTTCAGTTCNAGC
ARi49C09 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi50B10 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi56C02 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi60D01 pGCAP10 GGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT
ARi62D03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi63B05 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi63F04 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARi71D01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS013C18 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS013E20 pGCAP10 TGCTCTNNCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
ARiS013L08 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS023H05 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS023P19 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS085K07 pGCAP10 GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
ARiS096A13 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS096K01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
ARiS109J05 pGCAP10 GGGCGGCCTGCTCTCCGACAGAACTTTTCTTCTTGGGTTGAGGAAAACGCCTTTTGGAGT
ARiS191N22 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb01B01 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb03G01 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGNTAGAAAGCCATGTTCAGTTCGAG
RBb07G11 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb10C09 pKA1U5 GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGG
RBb12C12 pKA1U5 CTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCG
RBb18C01 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb20G11 pKA1U5 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGTTAGAAAGCCATGTTCAGTTCGAG
RBb35C06 pGCAP1 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb47F12 pGCAP1
RBb50D02 pGCAP1 GCTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTTCAGTTCG
RBb52B02 pGCAP1 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb53G06 pGCAP1 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAAGAAAGCCATGTTCAGTTCGAG
RBb57C12 pGCAP1 TGGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTT
RBb69E09 pGCAP1 GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
RBb70F09 pGCAP1 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBb71C04 pGCAP1 TTTGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCG
RBb72D01 pGCAP1 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd12E03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd12G05 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd18D06 pGCAP10 GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
RBd22D07 pGCAP10
RBd22F01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd30A05 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd36A08 pGCAP10 GGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT
RBd36G03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd37F05 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd51H01 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd52D12 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd56A04 pGCAP10 GCTTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCNTGTTCAGTTCGAG
RBd57B10 pGCAP10 CGGCCGGCCGATGCTCTTCCTAAGCCGGCGCTCGGCAAGGAGAANNNCATGTTCAGTTCG
RBd74F06 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd74G09 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd76D05 pGCAP10 GCGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGT
RBd87E03 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBd92E07 pGCAP10 GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
RBdS007E08 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGGAGAAAGCCATGTTCAGTTCGAGCGCCAAGATC
RBdS015M21 pGCAP10 GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
RBdS022B24 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBdS040L17 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBdS081E18 pGCAP10 GCTCAGTGATGTTCCGGTTTCCGCCCTCCTCCTCGCGCTGTTTCCGCCTCTTGCCTTCGG
RBdS081M20 pGCAP10 GGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGT
RBdS083B24 pGCAP10 GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
RBdS083N22 pGCAP10 GGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTT
RBdS104L19 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBdS154F21 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBdS154G17 pGCAP10 GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
RBdS177I12 pGCAP10 GGTTCAGTGGGAAGCATGTCGTCTTTATCGCTCAGAGGAGAATTCTGCCTAAGCCAACTC
RBdS177K22 pGCAP10 TGGGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl