Prev. |  KEGG KO K02993 > 

RIKEN DNA Bank Human Resource - RPS7

Gene ID NCBI Gene 6201 |  KEGG hsa:6201
Gene Symbol RPS7
Protein Name ribosomal protein S7
Synonyms DBA8|S7|eS7
Ortholog resources KEGG ortholog (KEGG orthology K02993) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053814 IRAK134I22 pCMV-SPORT6 BC061901 NM_001011 Full
HGY086053 IRAL015C05 pOTB7 BC002866 NM_001011 Full
HGY103385 IRAL058H17 pOTB7 BC071919 NM_001011 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081229 M01C003B05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081277 M01C003D05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081325 M01C003F05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081373 M01C003H05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081421 M01C003J05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081469 M01C003L05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081517 M01C003N05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE081565 M01C003P05 pDONR221 04-134-2_2-C03 BC002866 NM_001011  
HGE098433 M01C046B09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098481 M01C046D09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098529 M01C046F09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098577 M01C046H09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098625 M01C046J09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098673 M01C046L09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098721 M01C046N09 pDONR221 MGC12-G05 BC002866 NM_001011  
HGE098769 M01C046P09 pDONR221 MGC12-G05 BC002866 NM_001011  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040898 ARe02E02 pKA1U5 NM_001011.2  
GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGG
HKR041776 ARe04H08 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
HKR044549 ARe11G05 pKA1U5 NM_001011.2  
GTCTTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR044927 ARe12F07 pKA1U5 NM_001011.2  
TGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR045723 ARe14F03 pKA1U5 NM_001011.2  
GGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGATTCTCCCAGGAGAAAGCCATG
HKR046098 ARe15E02 pKA1U5 NM_001011.2  
TGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR049724 ARe24F04 pKA1U5 NM_001011.2  
ATCCTGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGT
HKR050849 ARe27C01 pKA1U5 NM_001011.2  
GCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCGC
HKR052449 ARe31C01 pKA1U5 NM_001011.2  
TGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR052908 ARe32E12 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR053256 ARe33C08 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR054879 ARe37D07 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR055328 ARe38F08 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
HKR055631 ARe39B07 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR056101 ARe40E05 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGTAGAAAGCCATGTTCAGTTCGAG
HKR060978 ARe52H10 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCNNNTAAAAAGCCATGTTCAGTTCGAG
HKR061633 ARe54B09 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR062578 ARe56H10 pKA1U5 NM_001011.2  
TGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCCCCNTNNAGAAAGCCATGTTCAGTTCGA
HKR068970 ARe72H02 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR070498 ARe76E02 pKA1U5 NM_001011.2  
GGGACGCCGGATTTTGACGTGCTCTCGCGAGACTTTNGTCTCTTCCTAAGCCGGCGCTCG
HKR070579 ARe76H11 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCCTTAGAAAGCCATGTTCAGTTCGAGC
HKR072974 ARe82H06 pKA1U5 NM_001011.2  
GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR073705 ARe84E09 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR074873 ARe87D01 pKA1U5 NM_001011.2  
GGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAA
HKR075699 ARe89E03 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR076012 ARe90A12 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR076034 ARe90B10 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR077203 ARe93A03 pKA1U5 NM_001011.2  
GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGGGTCTCTTCCTAAGCCGG
HKR077723 ARe94F03 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR078502 ARe96E06 pKA1U5 NM_001011.2  
GTCGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCC
HKR162049 ARi05C01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAGGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR162955 ARi07G11 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR166455 ARi16C07 pGCAP10 NM_001011.2  
GGACAAGAACTTGAAGCCTATCAAGCCCATGCAGTTTCTGGGGGATGAAGAGACGGTGCG
HKR166905 ARi17E09 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR167697 ARi19E01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR168571 ARi21H03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR169372 ARi23H04 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR170855 ARi27C07 pGCAP10 NM_001011.2  
GTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCG
HKR170897 ARi27E01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR175675 ARi39D03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR175732 ARi39F12 pGCAP10 NM_001011.2  
TGGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR176455 ARi41C07 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR178449 ARi46C01 pGCAP10 NM_001011.2  
GCTCTTCCCCCCCCGGCGCTCAGAGAGATCGCCCAGGAGAAATCCATGTTCAGTTCNAGC
HKR179657 ARi49C09 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR180034 ARi50B10 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR182450 ARi56C02 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR184073 ARi60D01 pGCAP10 NM_001011.2  
GGCGAGATTTGGGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT
HKR184875 ARi62D03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR185229 ARi63B05 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR185324 ARi63F04 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR188473 ARi71D01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR205266 ARiS013C18 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR205316 ARiS013E20 pGCAP10 NM_001011.2  
TGCTCTNNCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR205472 ARiS013L08 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR209373 ARiS023H05 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR209579 ARiS023P19 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR234247 ARiS085K07 pGCAP10 NM_001011.2  
GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR238413 ARiS096A13 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR238641 ARiS096K01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR243821 ARiS109J05 pGCAP10 NM_001011.2  
GGGCGGCCTGCTCTCCGACAGAACTTTTCTTCTTGGGTTGAGGAAAACGCCTTTTGGAGT
HKR276734 ARiS191N22 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR320425 RBb01B01 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR321345 RBb03G01 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGNTAGAAAGCCATGTTCAGTTCGAG
HKR322955 RBb07G11 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR324057 RBb10C09 pKA1U5 NM_001011.2  
GGCCTTCGGACGCCGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGG
HKR324860 RBb12C12 pKA1U5 NM_001011.2  
CTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGCG
HKR327249 RBb18C01 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR328155 RBb20G11 pKA1U5 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGTTAGAAAGCCATGTTCAGTTCGAG
HKR334054 RBb35C06 pGCAP1 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR338932 RBb47F12 pGCAP1 NM_001011.2  
HKR340074 RBb50D02 pGCAP1 NM_001011.2  
GCTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTTCAGTTCG
HKR340826 RBb52B02 pGCAP1 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR341350 RBb53G06 pGCAP1 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAAGAAAGCCATGTTCAGTTCGAG
HKR342860 RBb57C12 pGCAP1 NM_001011.2  
TGGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTT
HKR347705 RBb69E09 pGCAP1 NM_001011.2  
GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR348129 RBb70F09 pGCAP1 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR348452 RBb71C04 pGCAP1 NM_001011.2  
TTTGCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCG
HKR348873 RBb72D01 pGCAP1 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR364899 RBd12E03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR364949 RBd12G05 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR367278 RBd18D06 pGCAP10 NM_001011.2  
GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR368879 RBd22D07 pGCAP10 NM_001011.2  
HKR368921 RBd22F01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR372005 RBd30A05 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR374408 RBd36A08 pGCAP10 NM_001011.2  
GGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT
HKR374547 RBd36G03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR374925 RBd37F05 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR380569 RBd51H01 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR380884 RBd52D12 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR382404 RBd56A04 pGCAP10 NM_001011.2  
GCTTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCNTGTTCAGTTCGAG
HKR382834 RBd57B10 pGCAP10 NM_001011.2  
CGGCCGGCCGATGCTCTTCCTAAGCCGGCGCTCGGCAAGGAGAANNNCATGTTCAGTTCG
HKR389726 RBd74F06 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR389753 RBd74G09 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR390477 RBd76D05 pGCAP10 NM_001011.2  
GCGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGT
HKR394899 RBd87E03 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR396903 RBd92E07 pGCAP10 NM_001011.2  
GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR402904 RBdS007E08 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGGAGAAAGCCATGTTCAGTTCGAGCGCCAAGATC
HKR406309 RBdS015M21 pGCAP10 NM_001011.2  
GGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGA
HKR408848 RBdS022B24 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR416281 RBdS040L17 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR432514 RBdS081E18 pGCAP10 NM_001011.2  
GCTCAGTGATGTTCCGGTTTCCGCCCTCCTCCTCGCGCTGTTTCCGCCTCTTGCCTTCGG
HKR432708 RBdS081M20 pGCAP10 NM_001011.2  
GGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGT
HKR433248 RBdS083B24 pGCAP10 NM_001011.2  
GTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAG
HKR433534 RBdS083N22 pGCAP10 NM_001011.2  
GGGATTTTGACGTGCTCTCGCGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTT
HKR441883 RBdS104L19 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR461741 RBdS154F21 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR461761 RBdS154G17 pGCAP10 NM_001011.2  
GCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCATGTTCAGTTCGAGC
HKR471004 RBdS177I12 pGCAP10 NM_001011.2  
GGTTCAGTGGGAAGCATGTCGTCTTTATCGCTCAGAGGAGAATTCTGCCTAAGCCAACTC
HKR471062 RBdS177K22 pGCAP10 NM_001011.2  
TGGGAGATTTGTGTCTCTTCCTAAGCCGGCGCTCGGCAAGTTCTCCCAGGAGAAAGCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl