Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00320

HP ID(1) HP00320
Gene ID(2) 6181
Gene Symbol finder RPLP2
Protein Name ribosomal protein, large P2
RefSeq NM_001004.3
Length of RefSeq (bp) 511
Chromosome 11p15.5-p15.4
Reference DDBJ accession
UniGene Hs.437594

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08D06 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGAGACTTCTCCGCCGCCTCCGC
ARe12B04 pKA1U5 GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
ARe12C04 pKA1U5 GCCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCC
ARe13F12 pKA1U5 GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
ARe14G04 pKA1U5 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARe18A07 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe25C05 pKA1U5 GGCCTTCTGGGTAGCGGTTTAACCCCGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTG
ARe25E05 pKA1U5 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARe25E09 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe25F09 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe29E02 pKA1U5 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARe35G11 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCG
ARe40D03 pKA1U5 TGGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACNCNTTGNAGACTTCTCCGCCGCCTCC
ARe43B03 pKA1U5 GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCG
ARe55C05 pKA1U5 GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCG
ARe63G08 pKA1U5 TCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCC
ARe69B02 pKA1U5 ATCCTGGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGAGACTTCTCCGCCGC
ARe75A09 pKA1U5 GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCNCACGCGNTGAGACTTCTCCGCCGCCT
ARe75C10 pKA1U5 GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGNTGTAGACTTCTCCGCCGCCTCCG
ARe85F10 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe93A07 pKA1U5 GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe94B01 pKA1U5 CTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
ARe97H04 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARe99E10 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARf01G12 pKA1U5 GACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCC
ARf04F08 pKA1U5 GGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCT
ARf05H06 pKA1U5 GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARf07F03 pKA1U5 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi02H08 pGCAP10 CGGCCGGCCGATGGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTGTCGCCACCGAG
ARi11C10 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi13C07 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi15A01 pGCAP10 GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
ARi18F01 pGCAP10 GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGNNNCTTCTCCGCCGCCT
ARi20A01 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi22D02 pGCAP10 GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
ARi29F12 pGCAP10 CGGCCGGCCGATGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCC
ARi30A05 pGCAP10 GCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCC
ARi33G12 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi38A08 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi40F07 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi41F04 pGCAP10 GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
ARi44E07 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi44H03 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi48G10 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi52B06 pGCAP10 GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
ARi54A12 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARi59A09 pGCAP10 GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
ARi63D12 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARi63E06 pGCAP10 GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
ARi64D02 pGCAP10
ARiS008M02 pGCAP10 GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
ARiS013A22 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARiS013I11 pGCAP10 GCTTTTCCTCCCTGNCNCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARiS020J16 pGCAP10 GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
ARiS023K08 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS045J12 pGCAP10 GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
ARiS045P05 pGCAP10 GAGACGCCGCCGCGTGAGTGTGGTGACCGGGCCCGGGGTGCCGGCTGGGGACGCGGAGTC
ARiS049N02 pGCAP10 GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
ARiS055H13 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS085E21 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARiS087E24 pGCAP10
ARiS087H12 pGCAP10 TGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS088G19 pGCAP10 GAGATCCGCGCCCTGCNGCTNGGCGNTNAGGANNNNNACTTCCTGCCTGGATTCCNNANC
ARiS088N03 pGCAP10 GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
ARiS096A18 pGCAP10
ARiS096B06 pGCAP10 TCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS109C02 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS118F01 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS122J19 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARiS122O21 pGCAP10
ARiS150F21 pGCAP10 GCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACG
ARiS150N07 pGCAP10 GCCTTTTCCTCCCTGTCNCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS161E14 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS161O23 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
ARiS191K19 pGCAP10 GCTTCTGGGTAGCGGTTTAACCCCGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTGTC
ARiS194N18 pGCAP10 GNTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
ARiS198H18 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBb01B04 pKA1U5
RBb02G06 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBb03B12 pKA1U5 TTGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
RBb03C11 pKA1U5 AGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
RBb09E01 pKA1U5 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCGC
RBb15A03 pKA1U5 GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCC
RBb21B12 pKA1U5 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCGC
RBb21G07 pKA1U5 GGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCGC
RBb27D01 pGCAP1 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGACACTTCTCCGCCGCCTCCGC
RBd01H07 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd09E03 pGCAP10 CTTTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
RBd13F06 pGCAP10 GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
RBd15F10 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd20D11 pGCAP10 TGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd23B06 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd23E11 pGCAP10 GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
RBd24H01 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd25G03 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBd26F09 pGCAP10 GCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACG
RBd36B07 pGCAP10 CGGCCGGCCGATGCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCC
RBd37D02 pGCAP10 GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
RBd43H06 pGCAP10 GCTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
RBd48C01 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd53F04 pGCAP10 GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
RBd62B07 pGCAP10 TTTTTTTTTTTTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTC
RBd68E06 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBd69G06 pGCAP10 GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd70D08 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd71E03 pGCAP10 GTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
RBd75C10 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd83H09 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBd85C02 pGCAP10 GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
RBd85C05 pGCAP10 TTGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
RBd89C01 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS007I03 pGCAP10 GTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
RBdS007M18 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS007N03 pGCAP10 GCCTTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
RBdS007O08 pGCAP10 GGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCT
RBdS013L01 pGCAP10 CGGCCGGCCGATGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCG
RBdS022E10 pGCAP10 GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
RBdS040B09 pGCAP10 GCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGC
RBdS040F02 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS040L04 pGCAP10 AGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS051J05 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS051N21 pGCAP10 GGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCT
RBdS070B09 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS070K01 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS083D08 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS083E02 pGCAP10 GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS083M24 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS104G03 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS105O21 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS110B07 pGCAP10 GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS154P13 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS156F20 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS156K19 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS187M05 pGCAP10 GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
RBdS177C09 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
RBdS187I17 pGCAP10 GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl