Prev. |  KEGG KO K02943 > 

RIKEN DNA Bank Human Resource - RPLP2

Gene ID NCBI Gene 6181 |  KEGG hsa:6181
Gene Symbol RPLP2
Protein Name ribosomal protein lateral stalk subunit P2
Synonyms D11S2243E|LP2|P2|RPP2
Ortholog resources KEGG ortholog (KEGG orthology K02943) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086586 IRAL016H18 pDNR-LIB BC005354 NM_001004 Full
HGY088610 IRAL021I18 pDNR-LIB BC005920 NM_001004 Full
HGY088925 IRAL022F05 pOTB7 BC007573 NM_001004 Full
HGY100098 IRAL050E02 pOTB7 BC062314 NM_001004 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043278 ARe08D06 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGAGACTTCTCCGCCGCCTCCGC
HKR044828 ARe12B04 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
HKR044852 ARe12C04 pKA1U5 NM_001004.3  
GCCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCC
HKR045332 ARe13F12 pKA1U5 NM_001004.3  
GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
HKR045748 ARe14G04 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR047207 ARe18A07 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR050053 ARe25C05 pKA1U5 NM_001004.3  
GGCCTTCTGGGTAGCGGTTTAACCCCGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTG
HKR050101 ARe25E05 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR050105 ARe25E09 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR050129 ARe25F09 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR051698 ARe29E02 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR054155 ARe35G11 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCG
HKR056075 ARe40D03 pKA1U5 NM_001004.3  
TGGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACNCNTTGNAGACTTCTCCGCCGCCTCC
HKR057227 ARe43B03 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCG
HKR062053 ARe55C05 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCG
HKR065352 ARe63G08 pKA1U5 NM_001004.3  
TCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCC
HKR067626 ARe69B02 pKA1U5 NM_001004.3  
ATCCTGGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGAGACTTCTCCGCCGC
HKR070009 ARe75A09 pKA1U5 NM_001004.3  
GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCNCACGCGNTGAGACTTCTCCGCCGCCT
HKR070058 ARe75C10 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGNTGTAGACTTCTCCGCCGCCTCCG
HKR074130 ARe85F10 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR077207 ARe93A07 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR077625 ARe94B01 pKA1U5 NM_001004.3  
CTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
HKR078972 ARe97H04 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR079706 ARe99E10 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR080556 ARf01G12 pKA1U5 NM_001004.3  
GACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCC
HKR081728 ARf04F08 pKA1U5 NM_001004.3  
GGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCT
HKR082174 ARf05H06 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR082923 ARf07F03 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR160976 ARi02H08 pGCAP10 NM_001004.3  
CGGCCGGCCGATGGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTGTCGCCACCGAG
HKR164458 ARi11C10 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR165255 ARi13C07 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR166001 ARi15A01 pGCAP10 NM_001004.3  
GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
HKR167321 ARi18F01 pGCAP10 NM_001004.3  
GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGNNNCTTCTCCGCCGCCT
HKR168001 ARi20A01 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR168874 ARi22D02 pGCAP10 NM_001004.3  
GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
HKR171732 ARi29F12 pGCAP10 NM_001004.3  
CGGCCGGCCGATGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCC
HKR172005 ARi30A05 pGCAP10 NM_001004.3  
GCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCC
HKR173356 ARi33G12 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR175208 ARi38A08 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR176127 ARi40F07 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR176524 ARi41F04 pGCAP10 NM_001004.3  
GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
HKR177703 ARi44E07 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR177771 ARi44H03 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR179354 ARi48G10 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR180830 ARi52B06 pGCAP10 NM_001004.3  
GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
HKR181612 ARi54A12 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR183609 ARi59A09 pGCAP10 NM_001004.3  
GCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
HKR185284 ARi63D12 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR185302 ARi63E06 pGCAP10 NM_001004.3  
GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR185674 ARi64D02 pGCAP10 NM_001004.3  
HKR203490 ARiS008M02 pGCAP10 NM_001004.3  
GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR205222 ARiS013A22 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR205403 ARiS013I11 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGNCNCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR208232 ARiS020J16 pGCAP10 NM_001004.3  
GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR209448 ARiS023K08 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR218228 ARiS045J12 pGCAP10 NM_001004.3  
GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
HKR218365 ARiS045P05 pGCAP10 NM_001004.3  
GAGACGCCGCCGCGTGAGTGTGGTGACCGGGCCCGGGGTGCCGGCTGGGGACGCGGAGTC
HKR219914 ARiS049N02 pGCAP10 NM_001004.3  
GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
HKR222181 ARiS055H13 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR234117 ARiS085E21 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR234920 ARiS087E24 pGCAP10 NM_001004.3  
HKR234980 ARiS087H12 pGCAP10 NM_001004.3  
TGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR235363 ARiS088G19 pGCAP10 NM_001004.3  
GAGATCCGCGCCCTGCNGCTNGGCGNTNAGGANNNNNACTTCCTGCCTGGATTCCNNANC
HKR235515 ARiS088N03 pGCAP10 NM_001004.3  
GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR238418 ARiS096A18 pGCAP10 NM_001004.3  
HKR238430 ARiS096B06 pGCAP10 NM_001004.3  
TCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR243650 ARiS109C02 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR247321 ARiS118F01 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR249035 ARiS122J19 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR249157 ARiS122O21 pGCAP10 NM_001004.3  
HKR260141 ARiS150F21 pGCAP10 NM_001004.3  
GCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACG
HKR260319 ARiS150N07 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCNCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR264510 ARiS161E14 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR264759 ARiS161O23 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR276659 ARiS191K19 pGCAP10 NM_001004.3  
GCTTCTGGGTAGCGGTTTAACCCCGCCTCTTGCGTCGGCGCCTTCCTTTTCCTCCCTGTC
HKR277930 ARiS194N18 pGCAP10 NM_001004.3  
GNTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR279386 ARiS198H18 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR320428 RBb01B04 pKA1U5 NM_001004.3  
HKR320950 RBb02G06 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR321236 RBb03B12 pKA1U5 NM_001004.3  
TTGCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
HKR321259 RBb03C11 pKA1U5 NM_001004.3  
AGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
HKR323697 RBb09E01 pKA1U5 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCCGC
HKR326003 RBb15A03 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGNTCGCCACCGAGGTCGCACGCGTTGTAGACTTCTCCGCCGCCTCC
HKR328436 RBb21B12 pKA1U5 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCGC
HKR328551 RBb21G07 pKA1U5 NM_001004.3  
GGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTTGAGACTTCTCCGCCGCCTCCGC
HKR330873 RBb27D01 pGCAP1 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGNTGACACTTCTCCGCCGCCTCCGC
HKR360575 RBd01H07 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR363699 RBd09E03 pGCAP10 NM_001004.3  
CTTTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
HKR365326 RBd13F06 pGCAP10 NM_001004.3  
GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
HKR366130 RBd15F10 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR368083 RBd20D11 pGCAP10 NM_001004.3  
TGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR369230 RBd23B06 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR369307 RBd23E11 pGCAP10 NM_001004.3  
GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR369769 RBd24H01 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR370147 RBd25G03 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR370529 RBd26F09 pGCAP10 NM_001004.3  
GCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACG
HKR374431 RBd36B07 pGCAP10 NM_001004.3  
CGGCCGGCCGATGCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCC
HKR374874 RBd37D02 pGCAP10 NM_001004.3  
GGCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
HKR377374 RBd43H06 pGCAP10 NM_001004.3  
GCTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCC
HKR379249 RBd48C01 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR381324 RBd53F04 pGCAP10 NM_001004.3  
GCCTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR384831 RBd62B07 pGCAP10 NM_001004.3  
TTTTTTTTTTTTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTC
HKR387302 RBd68E06 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR387750 RBd69G06 pGCAP10 NM_001004.3  
GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR388080 RBd70D08 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR388499 RBd71E03 pGCAP10 NM_001004.3  
GTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
HKR390058 RBd75C10 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR393377 RBd83H09 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR394050 RBd85C02 pGCAP10 NM_001004.3  
GCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCC
HKR394053 RBd85C05 pGCAP10 NM_001004.3  
TTGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
HKR395649 RBd89C01 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR402995 RBdS007I03 pGCAP10 NM_001004.3  
GTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCG
HKR403106 RBdS007M18 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR403115 RBdS007N03 pGCAP10 NM_001004.3  
GCCTTTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCT
HKR403144 RBdS007O08 pGCAP10 NM_001004.3  
GGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCT
HKR405465 RBdS013L01 pGCAP10 NM_001004.3  
CGGCCGGCCGATGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCG
HKR408906 RBdS022E10 pGCAP10 NM_001004.3  
GCTTTTTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTC
HKR416033 RBdS040B09 pGCAP10 NM_001004.3  
GCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGC
HKR416122 RBdS040F02 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR416268 RBdS040L04 pGCAP10 NM_001004.3  
AGCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR420621 RBdS051J05 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR420733 RBdS051N21 pGCAP10 NM_001004.3  
GGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCT
HKR428033 RBdS070B09 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR428241 RBdS070K01 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR433280 RBdS083D08 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR433298 RBdS083E02 pGCAP10 NM_001004.3  
GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR433512 RBdS083M24 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR441747 RBdS104G03 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR442357 RBdS105O21 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR444031 RBdS110B07 pGCAP10 NM_001004.3  
GCTTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR461973 RBdS154P13 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR462540 RBdS156F20 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR462659 RBdS156K19 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG
HKR470857 RBdS177C09 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR475009 RBdS187I17 pGCAP10 NM_001004.3  
GCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCC
HKR475093 RBdS187M05 pGCAP10 NM_001004.3  
GCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl