Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00301

HP ID(1) HP00301
Gene ID(2) 6133
Gene Symbol finder RPL9
Protein Name ribosomal protein L9
RefSeq NM_000661.4
Length of RefSeq (bp) 766
Chromosome 4p13
Reference DDBJ accession
UniGene Hs.412370

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03A08 pKA1U5 GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
ARe06B09 pKA1U5 GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
ARe11B07 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe12A07 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe27A08 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe35F07 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe36D06 pKA1U5 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
ARe42E04 pKA1U5 ATCCTGGGGGAGACGTTCTTTCTTTGCTGCGTCTACNTGCGAGAATGAAGACCTATTCCT
ARe42F04 pKA1U5 GGCGCGGGGCCGCGACCTGTGCCGGCTCGAGCCCGCTTGGGCACTCGGAGGCGCGCACGA
ARe43E04 pKA1U5 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
ARe44F07 pKA1U5 GCTTTTCTTTGCTGCGTCTACTGCGAGAATGACCNCTNTTCTCAGCAATCAGACTGTCGA
ARe45H06 pKA1U5 GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
ARe46G04 pKA1U5 GCTTTCTTTGCTGCGNTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
ARe51G12 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe53E12 pKA1U5 GAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGAC
ARe74D05 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe83C01 pKA1U5 GNGTNNGNGTGNGCTNANCGTGCNCAGAANGNNGACGTATTCCTCNGACNCTCAGGACAT
ARe85A03 pKA1U5 GCTTTCTTTGCTGCGCTCTACTGCGAGGCTGGGACACACTGGGGCCCGCTGCTCGGTCTC
ARe87G05 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe89E07 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARe95D05 pKA1U5 GGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGC
ARe95H07 pKA1U5 GGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGC
ARe98D06 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi07A08 pGCAP10 TGTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi10A11 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi10H04 pGCAP10 AATCCTTGAAGGAAATGACATTGAGCTTGTTTCAAATTCAGCGGCTTTGATTCAGCAAGC
ARi11A08 pGCAP10 TGGCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACAT
ARi12A05 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi16H12 pGCAP10 GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
ARi21C11 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi23B03 pGCAP10 AATCCTTGAAGGAAATGACATTGAGCTTGTTTCAAATTCAGCGGCTTTGATTCAGCAAGC
ARi26B10 pGCAP10 GCTTTTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTC
ARi26E06 pGCAP10 GAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGAC
ARi27C04 pGCAP10 GGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGA
ARi28H04 pGCAP10 GGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGAAAATG
ARi33F07 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi43D02 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi43D10 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi45B09 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
ARi45G02 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARi62B09 pGCAP10 TGGCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACAT
ARiS013C01 pGCAP10 GCTTTCTTTGCTGCNNCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS013E12 pGCAP10 GCTTTCTTTGCTGCGNCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS023M08 pGCAP10 GTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
ARiS045F19 pGCAP10 AAGTNCNTANTGACNACANACNTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTA
ARiS049P22 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS055F18 pGCAP10 CTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS118F08 pGCAP10 GCTTTTTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGT
ARiS118J01 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS118J16 pGCAP10 GNTNCCCTGNNTCTNCTGCCAGANTGAAAACTATTCTCAACAATNNNANNGTCNACNTTC
ARiS161J08 pGCAP10 GGCGTCTACTGCNANAATGANNACTATTCTCAGCAATCAGACTGTCGACATTCCAGAAAA
ARiS191C10 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
ARiS191I21 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBb07C04 pKA1U5 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBb14E12 pKA1U5 GCTTTTCTTTGCTGCGTCTACTGCGAGAATGACCACTATTCTCAGCAATCAGACTGTCGA
RBb39F08 pGCAP1 TGTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
RBb55D08 pGCAP1 GGACAGACGTTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATC
RBb60H01 pGCAP1 GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
RBb67G05 pGCAP1 TTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
RBd10F08 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd17C08 pGCAP10 AGGTAAGGATGTTTCTGTGCTCCTGGGGGTACTGGGAATCTGAAACCATCTGCTCTGGGA
RBd22H02 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd25A08 pGCAP10 GTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
RBd26F12 pGCAP10 GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd31F09 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd40F04 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBd43B08 pGCAP10 TGGAGGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTG
RBd45F05 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd63F05 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd66E03 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd67D12 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBd68F03 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBd69E07 pGCAP10 GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
RBd78G08 pGCAP10 GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
RBd94A12 pGCAP10 TTGGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTC
RBd97B07 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBd98H03 pGCAP10 GAATGACGACAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAG
RBdS007B21 pGCAP10 GCTTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCG
RBdS007J05 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBdS013O15 pGCAP10 GGGACGACAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCA
RBdS015N11 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS040J11 pGCAP10 GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
RBdS070H01 pGCAP10 GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS075B23 pGCAP10 GCTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
RBdS075D16 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBdS075I09 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS104J17 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBdS110B01 pGCAP10 GGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGA
RBdS110L10 pGCAP10 GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
RBdS110O14 pGCAP10 GCTTTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTG
RBdS132L16 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS154L06 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS156K15 pGCAP10 GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS187B01 pGCAP10 GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
RBdS187J12 pGCAP10 TAGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCNNCAATCANACTGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl