Prev. |  KEGG KO K02940 > 

RIKEN DNA Bank Human Resource - RPL9

Gene ID NCBI Gene 6133 |  KEGG hsa:6133
Gene Symbol RPL9
Protein Name ribosomal protein L9
Synonyms L9|NPC-A-16
Ortholog resources KEGG ortholog (KEGG orthology K02940) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017058 IRAK042K18 pCMV-SPORT6 BC031906 NM_001024921 Full
HGY067203 IRAK168A03 pBluescriptR BC066318 NM_001024921 Full
HGY080783 IRAL001P23 pOTB7 BC000483 NM_001024921 Full
HGY081160 IRAL002O24 pOTB7 BC004156 NM_001024921 Full
HGY084163 IRAL010G19 pOTB7 BC004206 NM_001024921 Full
HGY088372 IRAL020P12 pOTB7 BC007967 NM_001024921 Full
HGY091695 IRAL029D23 pOTB7 BC012149 NM_001024921 Full
HGY103055 IRAL057K15 pDNR-LIB BC070214 NM_001024921 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041208 ARe03A08 pKA1U5 NM_000661.4  
GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR042433 ARe06B09 pKA1U5 NM_000661.4  
GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR044431 ARe11B07 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR044807 ARe12A07 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR050808 ARe27A08 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR054127 ARe35F07 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR054478 ARe36D06 pKA1U5 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR056900 ARe42E04 pKA1U5 NM_000661.4  
ATCCTGGGGGAGACGTTCTTTCTTTGCTGCGTCTACNTGCGAGAATGAAGACCTATTCCT
HKR056924 ARe42F04 pKA1U5 NM_000661.4  
GGCGCGGGGCCGCGACCTGTGCCGGCTCGAGCCCGCTTGGGCACTCGGAGGCGCGCACGA
HKR057300 ARe43E04 pKA1U5 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR057727 ARe44F07 pKA1U5 NM_000661.4  
GCTTTTCTTTGCTGCGTCTACTGCGAGAATGACCNCTNTTCTCAGCAATCAGACTGTCGA
HKR058174 ARe45H06 pKA1U5 NM_000661.4  
GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR058548 ARe46G04 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGNTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
HKR060556 ARe51G12 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR061308 ARe53E12 pKA1U5 NM_000661.4  
GAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGAC
HKR069677 ARe74D05 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR073249 ARe83C01 pKA1U5 NM_000661.4  
GNGTNNGNGTGNGCTNANCGTGCNCAGAANGNNGACGTATTCCTCNGACNCTCAGGACAT
HKR074003 ARe85A03 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGCTCTACTGCGAGGCTGGGACACACTGGGGCCCGCTGCTCGGTCTC
HKR074949 ARe87G05 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR075703 ARe89E07 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR078077 ARe95D05 pKA1U5 NM_000661.4  
GGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGC
HKR078175 ARe95H07 pKA1U5 NM_000661.4  
GGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGC
HKR079278 ARe98D06 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR162808 ARi07A08 pGCAP10 NM_000661.4  
TGTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR164011 ARi10A11 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR164172 ARi10H04 pGCAP10 NM_000661.4  
AATCCTTGAAGGAAATGACATTGAGCTTGTTTCAAATTCAGCGGCTTTGATTCAGCAAGC
HKR164408 ARi11A08 pGCAP10 NM_000661.4  
TGGCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACAT
HKR164805 ARi12A05 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR166580 ARi16H12 pGCAP10 NM_000661.4  
GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
HKR168459 ARi21C11 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR169227 ARi23B03 pGCAP10 NM_000661.4  
AATCCTTGAAGGAAATGACATTGAGCTTGTTTCAAATTCAGCGGCTTTGATTCAGCAAGC
HKR170434 ARi26B10 pGCAP10 NM_000661.4  
GCTTTTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTC
HKR170502 ARi26E06 pGCAP10 NM_000661.4  
GAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGAC
HKR170852 ARi27C04 pGCAP10 NM_000661.4  
GGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGA
HKR171372 ARi28H04 pGCAP10 NM_000661.4  
GGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGAAAATG
HKR173327 ARi33F07 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR177274 ARi43D02 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR177282 ARi43D10 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR178033 ARi45B09 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR178146 ARi45G02 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR184833 ARi62B09 pGCAP10 NM_000661.4  
TGGCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACAT
HKR205249 ARiS013C01 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCNNCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR205308 ARiS013E12 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGNCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR209496 ARiS023M08 pGCAP10 NM_000661.4  
GTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
HKR218139 ARiS045F19 pGCAP10 NM_000661.4  
AAGTNCNTANTGACNACANACNTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTA
HKR219982 ARiS049P22 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR222138 ARiS055F18 pGCAP10 NM_000661.4  
CTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR247328 ARiS118F08 pGCAP10 NM_000661.4  
GCTTTTTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGT
HKR247417 ARiS118J01 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR247432 ARiS118J16 pGCAP10 NM_000661.4  
GNTNCCCTGNNTCTNCTGCCAGANTGAAAACTATTCTCAACAATNNNANNGTCNACNTTC
HKR264624 ARiS161J08 pGCAP10 NM_000661.4  
GGCGTCTACTGCNANAATGANNACTATTCTCAGCAATCAGACTGTCGACATTCCAGAAAA
HKR276458 ARiS191C10 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR276613 ARiS191I21 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR322852 RBb07C04 pKA1U5 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR325708 RBb14E12 pKA1U5 NM_000661.4  
GCTTTTCTTTGCTGCGTCTACTGCGAGAATGACCACTATTCTCAGCAATCAGACTGTCGA
HKR335728 RBb39F08 pGCAP1 NM_000661.4  
TGTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR342080 RBb55D08 pGCAP1 NM_000661.4  
GGACAGACGTTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATC
HKR344169 RBb60H01 pGCAP1 NM_000661.4  
GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR346949 RBb67G05 pGCAP1 NM_000661.4  
TTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
HKR364128 RBd10F08 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR366856 RBd17C08 pGCAP10 NM_000661.4  
AGGTAAGGATGTTTCTGTGCTCCTGGGGGTACTGGGAATCTGAAACCATCTGCTCTGGGA
HKR368970 RBd22H02 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR370008 RBd25A08 pGCAP10 NM_000661.4  
GTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
HKR370532 RBd26F12 pGCAP10 NM_000661.4  
GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR372529 RBd31F09 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR376124 RBd40F04 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR377232 RBd43B08 pGCAP10 NM_000661.4  
TGGAGGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTG
HKR378125 RBd45F05 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR385325 RBd63F05 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR386499 RBd66E03 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR386884 RBd67D12 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR387323 RBd68F03 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR387703 RBd69E07 pGCAP10 NM_000661.4  
GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
HKR391352 RBd78G08 pGCAP10 NM_000661.4  
GCTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACA
HKR397612 RBd94A12 pGCAP10 NM_000661.4  
TTGGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTC
HKR398831 RBd97B07 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR399371 RBd98H03 pGCAP10 NM_000661.4  
GAATGACGACAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAG
HKR402845 RBdS007B21 pGCAP10 NM_000661.4  
GCTTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCG
HKR403021 RBdS007J05 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR405551 RBdS013O15 pGCAP10 NM_000661.4  
GGGACGACAGACGTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCA
HKR406323 RBdS015N11 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR416227 RBdS040J11 pGCAP10 NM_000661.4  
GCTTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGA
HKR428169 RBdS070H01 pGCAP10 NM_000661.4  
GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR430047 RBdS075B23 pGCAP10 NM_000661.4  
GCTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATT
HKR430088 RBdS075D16 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR430201 RBdS075I09 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR441833 RBdS104J17 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR444025 RBdS110B01 pGCAP10 NM_000661.4  
GGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGA
HKR444274 RBdS110L10 pGCAP10 NM_000661.4  
GCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTC
HKR444350 RBdS110O14 pGCAP10 NM_000661.4  
GCTTTTCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTG
HKR453080 RBdS132L16 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR461870 RBdS154L06 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR462655 RBdS156K15 pGCAP10 NM_000661.4  
GCTTTTTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR474825 RBdS187B01 pGCAP10 NM_000661.4  
GCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCAGCAATCAGACTGTCGAC
HKR475028 RBdS187J12 pGCAP10 NM_000661.4  
TAGCTTTCTTTGCTGCGTCTACTGCGAGAATGAAGACTATTCTCNNCAATCANACTGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl