Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00285

HP ID(1) HP00285
Gene ID(2) 6231
Gene Symbol finder RPS26
Protein Name ribosomal protein S26
RefSeq NM_001029.3
Length of RefSeq (bp) 699
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.567235

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12A01 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe22D12 pKA1U5 TTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARe32G08 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe35D12 pKA1U5 TAAGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
ARe37B11 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe37F12 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe41G09 pKA1U5 ATCCTGTGCTCTCTCCGGTCCGTGCCTCCAAGANGATNAAGAAAAGAAGGAACAATGGTC
ARe43C06 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe49G03 pKA1U5 GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
ARe50A04 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe54F07 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe56E02 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGAATGACAAACCCNTTNAAGGAACAATGGTCGTGCC
ARe58B04 pKA1U5 GCTCTCTCCGGGTCCGTGCCTCCCAGATGACAAAGAATAGAANGAACAATGGTCGTGCCA
ARe65H11 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe68B09 pKA1U5 GCTCTCTCCGGTTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
ARe76B07 pKA1U5 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACACATTTAAAGAAGGAACAATGGTCGTGC
ARe76B10 pKA1U5 GGCGCACAGAGCTCTCAGCGCCGCTCCCAGCCACAGTTCATCCCGCGCCTCGCTCAGCTC
ARe78F10 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe81A03 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARe86A11 pKA1U5 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARf02F06 pKA1U5 ATCCTGGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCG
ARi05E07 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARi08E05 pGCAP10 GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
ARi09A08 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARi09B04 pGCAP10 TCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
ARi23D05 pGCAP10 GATCCGGCTAAATAGTCCCATGTGCACTTTGTTCCATGGATAAATAAACACTAGGAACGC
ARi37C08 pGCAP10 GCCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARi41B09 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARi46E09 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARi48E11 pGCAP10 GTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
ARi49A02 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARi51B01 pGCAP10 TCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
ARi54B07 pGCAP10 GNTCTCNNGCCCGCCCCTCCCAGATGACNATGAAAATAAGGAACTATGGTCGTGCCAAAA
ARi61C07 pGCAP10 GCTCGATTTTCTTCCGCCATCCGGCTAAATAGTCCCATGTGCACTTTGTTCCATGGATAA
ARi64E12 pGCAP10 GCTCTCTCCGGNCCGNGCCTCCAAGANGACNNAGAAAANANNNTCAATGGTCNNGCCAAA
ARi66F07 pGCAP10 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
ARi69G06 pGCAP10 ACGCTCTCTCCGGTCCGTGCCTCCTAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARi70D09 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCGAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARi70H08 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARiS008B19 pGCAP10 CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
ARiS008J08 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS008M22 pGCAP10 GCTCTCTCCGGTCCNNGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS013N13 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS023L04 pGCAP10 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
ARiS045C11 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS045L02 pGCAP10 GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
ARiS055A17 pGCAP10 GCTCTCTCCGGTCCNNGCCTCCNANATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS055G24 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS085B04 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS085D20 pGCAP10 GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
ARiS088K21 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARiS088L06 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
ARiS191G07 pGCAP10 CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
ARiS198H14 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
ARiS198O21 pGCAP10 GNNCNCNNCGGNCCGGGCCNCCNNGNGGCCNNCGNNNNNCGGNNCNTCGGNCNNGCCANN
RBb10A07 pKA1U5 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBb13E06 pKA1U5 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBb19D06 pKA1U5 GCTCTCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTG
RBb24E08 pGCAP1 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBb24H03 pGCAP1 TGTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
RBb24H04 pGCAP1 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBb28D03 pGCAP1 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBb36H02 pGCAP1 GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBb38B06 pGCAP1 GGTCTCCGGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
RBb38D03 pGCAP1 GGTCTCCGGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
RBb51D05 pGCAP1 GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBb51E08 pGCAP1 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBb52E03 pGCAP1 TGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBb55C12 pGCAP1 TCTCTCTCCGGTCCGTGCCTCCNAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBb56G03 pGCAP1 TCTCTCTCCGGTCCGTGCCTCCNAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBb57A04 pGCAP1 CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
RBb68F08 pGCAP1 GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
RBd02D04 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd02D08 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd03C12 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd08F03 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd16G12 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd23H03 pGCAP10 TGGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
RBd33F11 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd38A12 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd40H05 pGCAP10 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBd45E06 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd48A01 pGCAP10 GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
RBd52A08 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd55E10 pGCAP10 GCCNNGNNNCCGGNCCGTGCCNTCNCAGNNGNCCANNGAAAAGGAAGGNNNNNNGNCCGT
RBd72C03 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd74E11 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd77H07 pGCAP10 GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
RBd78A08 pGCAP10 GTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAAA
RBd80E06 pGCAP10 GCTCCNGTCTCCNGNCCGTGCCTCCNAGATGACAAAGAAAANAAGGAACAATGNTCNTGC
RBd81H11 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBd89C12 pGCAP10 GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBd94C04 pGCAP10 TGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBd96G05 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS007I13 pGCAP10 GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
RBdS013G01 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS013G11 pGCAP10 GCTCTCTCCGGTCCGNGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS013J16 pGCAP10 GCNCNNTCTCCGGTCCNTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
RBdS014B10 pGCAP10 GCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS014C20 pGCAP10 CGGCCGGCCGATGCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAA
RBdS014O13 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
RBdS015G12 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBdS051J16 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS070B13 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS075F23 pGCAP10 GCCTCNCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBdS081E19 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBdS081M11 pGCAP10 GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
RBdS105H17 pGCAP10 GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
RBdS105J03 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS110H17 pGCAP10 GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
RBdS110O17 pGCAP10 GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS154D16 pGCAP10 GCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
RBdS156H13 pGCAP10 GAGGCACCGTCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl