Prev. |  KEGG KO K02976 > 

RIKEN DNA Bank Human Resource - RPS26

Gene ID NCBI Gene 6231 |  KEGG hsa:6231
Gene Symbol RPS26
Protein Name ribosomal protein S26
Synonyms DBA10|S26|eS26
Ortholog resources KEGG ortholog (KEGG orthology K02976) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081878 IRAL004L14 pOTB7 BC002604 NM_001029 Full
HGY095562 IRAL038P02 pDNR-LIB BC015832 NM_001029 Full
HGY102996 IRAL057I04 pDNR-LIB BC070220 NM_001029 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088425 M01C021B01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088473 M01C021D01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088521 M01C021F01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088569 M01C021H01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088617 M01C021J01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088665 M01C021L01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088713 M01C021N01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE088761 M01C021P01 pDONR221 IMS03-C01 BC002604 NM_001029  
HGE100014 M01C050A14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100062 M01C050C14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100110 M01C050E14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100158 M01C050G14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100206 M01C050I14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100254 M01C050K14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100302 M01C050M14 pDONR221 MGC14-F07 BC002604 NM_001029  
HGE100350 M01C050O14 pDONR221 MGC14-F07 BC002604 NM_001029  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044801 ARe12A01 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR048884 ARe22D12 pKA1U5 NM_001029.3  
TTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR052952 ARe32G08 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR054084 ARe35D12 pKA1U5 NM_001029.3  
TAAGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR054835 ARe37B11 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR054932 ARe37F12 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR056553 ARe41G09 pKA1U5 NM_001029.3  
ATCCTGTGCTCTCTCCGGTCCGTGCCTCCAAGANGATNAAGAAAAGAAGGAACAATGGTC
HKR057254 ARe43C06 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR059747 ARe49G03 pKA1U5 NM_001029.3  
GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR060004 ARe50A04 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR061727 ARe54F07 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR062498 ARe56E02 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGAATGACAAACCCNTTNAAGGAACAATGGTCGTGCC
HKR063228 ARe58B04 pKA1U5 NM_001029.3  
GCTCTCTCCGGGTCCGTGCCTCCCAGATGACAAAGAATAGAANGAACAATGGTCGTGCCA
HKR066179 ARe65H11 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR067233 ARe68B09 pKA1U5 NM_001029.3  
GCTCTCTCCGGTTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR070431 ARe76B07 pKA1U5 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACACATTTAAAGAAGGAACAATGGTCGTGC
HKR070434 ARe76B10 pKA1U5 NM_001029.3  
GGCGCACAGAGCTCTCAGCGCCGCTCCCAGCCACAGTTCATCCCGCGCCTCGCTCAGCTC
HKR071330 ARe78F10 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR072403 ARe81A03 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR074411 ARe86A11 pKA1U5 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR080926 ARf02F06 pKA1U5 NM_001029.3  
ATCCTGGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCG
HKR162103 ARi05E07 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR163301 ARi08E05 pGCAP10 NM_001029.3  
GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR163608 ARi09A08 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR163628 ARi09B04 pGCAP10 NM_001029.3  
TCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR169277 ARi23D05 pGCAP10 NM_001029.3  
GATCCGGCTAAATAGTCCCATGTGCACTTTGTTCCATGGATAAATAAACACTAGGAACGC
HKR174856 ARi37C08 pGCAP10 NM_001029.3  
GCCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR176433 ARi41B09 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR178505 ARi46E09 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR179307 ARi48E11 pGCAP10 NM_001029.3  
GTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR179602 ARi49A02 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR180425 ARi51B01 pGCAP10 NM_001029.3  
TCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR181631 ARi54B07 pGCAP10 NM_001029.3  
GNTCTCNNGCCCGCCCCTCCCAGATGACNATGAAAATAAGGAACTATGGTCGTGCCAAAA
HKR184455 ARi61C07 pGCAP10 NM_001029.3  
GCTCGATTTTCTTCCGCCATCCGGCTAAATAGTCCCATGTGCACTTTGTTCCATGGATAA
HKR185708 ARi64E12 pGCAP10 NM_001029.3  
GCTCTCTCCGGNCCGNGCCTCCAAGANGACNNAGAAAANANNNTCAATGGTCNNGCCAAA
HKR186527 ARi66F07 pGCAP10 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR187750 ARi69G06 pGCAP10 NM_001029.3  
ACGCTCTCTCCGGTCCGTGCCTCCTAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR188081 ARi70D09 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCGAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR188176 ARi70H08 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR203243 ARiS008B19 pGCAP10 NM_001029.3  
CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR203424 ARiS008J08 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR203510 ARiS008M22 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCNNGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR205525 ARiS013N13 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR209468 ARiS023L04 pGCAP10 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR218059 ARiS045C11 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR218266 ARiS045L02 pGCAP10 NM_001029.3  
GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR222017 ARiS055A17 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCNNGCCTCCNANATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR222168 ARiS055G24 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR234028 ARiS085B04 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR234092 ARiS085D20 pGCAP10 NM_001029.3  
GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR235461 ARiS088K21 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR235470 ARiS088L06 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR276551 ARiS191G07 pGCAP10 NM_001029.3  
CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR279382 ARiS198H14 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR279557 ARiS198O21 pGCAP10 NM_001029.3  
GNNCNCNNCGGNCCGGGCCNCCNNGNGGCCNNCGNNNNNCGGNNCNTCGGNCNNGCCANN
HKR324007 RBb10A07 pKA1U5 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR325302 RBb13E06 pKA1U5 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR327678 RBb19D06 pKA1U5 NM_001029.3  
GCTCTCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTG
HKR329704 RBb24E08 pGCAP1 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR329771 RBb24H03 pGCAP1 NM_001029.3  
TGTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR329772 RBb24H04 pGCAP1 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR331275 RBb28D03 pGCAP1 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR334570 RBb36H02 pGCAP1 NM_001029.3  
GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR335230 RBb38B06 pGCAP1 NM_001029.3  
GGTCTCCGGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR335275 RBb38D03 pGCAP1 NM_001029.3  
GGTCTCCGGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR340477 RBb51D05 pGCAP1 NM_001029.3  
GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR340504 RBb51E08 pGCAP1 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR340899 RBb52E03 pGCAP1 NM_001029.3  
TGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR342060 RBb55C12 pGCAP1 NM_001029.3  
TCTCTCTCCGGTCCGTGCCTCCNAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR342547 RBb56G03 pGCAP1 NM_001029.3  
TCTCTCTCCGGTCCGTGCCTCCNAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR342804 RBb57A04 pGCAP1 NM_001029.3  
CTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR347328 RBb68F08 pGCAP1 NM_001029.3  
GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR360876 RBd02D04 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR360880 RBd02D08 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR361260 RBd03C12 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR363323 RBd08F03 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR366556 RBd16G12 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR369371 RBd23H03 pGCAP10 NM_001029.3  
TGGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAA
HKR373331 RBd33F11 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR375212 RBd38A12 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR376173 RBd40H05 pGCAP10 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR378102 RBd45E06 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR379201 RBd48A01 pGCAP10 NM_001029.3  
GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR380808 RBd52A08 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR382106 RBd55E10 pGCAP10 NM_001029.3  
GCCNNGNNNCCGGNCCGTGCCNTCNCAGNNGNCCANNGAAAAGGAAGGNNNNNNGNCCGT
HKR388851 RBd72C03 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR389707 RBd74E11 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR390975 RBd77H07 pGCAP10 NM_001029.3  
GCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR391208 RBd78A08 pGCAP10 NM_001029.3  
GTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAAA
HKR392102 RBd80E06 pGCAP10 NM_001029.3  
GCTCCNGTCTCCNGNCCGTGCCTCCNAGATGACAAAGAAAANAAGGAACAATGNTCNTGC
HKR392579 RBd81H11 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR395660 RBd89C12 pGCAP10 NM_001029.3  
GCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR397652 RBd94C04 pGCAP10 NM_001029.3  
TGCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR398549 RBd96G05 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR403005 RBdS007I13 pGCAP10 NM_001029.3  
GCTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGC
HKR405345 RBdS013G01 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR405355 RBdS013G11 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGNGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR405432 RBdS013J16 pGCAP10 NM_001029.3  
GCNCNNTCTCCGGTCCNTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR405634 RBdS014B10 pGCAP10 NM_001029.3  
GCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR405668 RBdS014C20 pGCAP10 NM_001029.3  
CGGCCGGCCGATGCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAA
HKR405949 RBdS014O13 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR406156 RBdS015G12 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR420632 RBdS051J16 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR428037 RBdS070B13 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR430143 RBdS075F23 pGCAP10 NM_001029.3  
GCCTCNCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR432515 RBdS081E19 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR432699 RBdS081M11 pGCAP10 NM_001029.3  
GCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCA
HKR442185 RBdS105H17 pGCAP10 NM_001029.3  
GGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAA
HKR442219 RBdS105J03 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR444185 RBdS110H17 pGCAP10 NM_001029.3  
GTCCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCC
HKR444353 RBdS110O17 pGCAP10 NM_001029.3  
GCTCTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR461688 RBdS154D16 pGCAP10 NM_001029.3  
GCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAATGGTCGTGCCAA
HKR462581 RBdS156H13 pGCAP10 NM_001029.3  
GAGGCACCGTCTCCTGTCTCCGGTCCGTGCCTCCAAGATGACAAAGAAAAGAAGGAACAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl