Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00277

HP ID(1) HP00277
Gene ID(2) 708
Gene Symbol finder C1QBP
Protein Name complement component 1, q subcomponent binding protein
RefSeq NM_001212.3
Length of RefSeq (bp) 1163
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.555866

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02C05 pKA1U5 GGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGCTGTTCGCAGTCGTTTCCGCGATGCT
ARf04A08 pKA1U5 TGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCG
ARi20E01 pGCAP10 GAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTC
ARi21F11 pGCAP10 GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
ARiS008L15 pGCAP10 GCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGT
RBb05F03 pKA1U5 ATCCTGGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCG
RBd07G07 pGCAP10 GGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCGT
RBd29F10 pGCAP10 GGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTC
RBd58E05 pGCAP10 TTGAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCNNNNTGCTGGGCTCCTC
RBd75E01 pGCAP10 GGGGCAGGGGCGGGGCTTCCGGCGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGT
RBd80A07 pGCAP10 GGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAG
RBd93A02 pGCAP10 GGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCC
RBd95B08 pGCAP10 GAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCG
RBdS007F06 pGCAP10 GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
RBdS015C11 pGCAP10 CGGCCGGCCGATGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl