Prev. |  KEGG KO K15414 > 

RIKEN DNA Bank Human Resource - C1QBP

Gene ID NCBI Gene 708 |  KEGG hsa:708
Gene Symbol C1QBP
Protein Name complement C1q binding protein
Synonyms COXPD33|GC1QBP|HABP1|SF2AP32|SF2p32|gC1Q-R|gC1qR|p32
Ortholog resource in our bank

  C1QBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008582 IRAK021H14 pCMV-SPORT6 BC013731 NM_001212 Full
HGY080447 IRAL001B23 pOTB7 BC000435 NM_001212 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099620 M01C049A20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099668 M01C049C20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099716 M01C049E20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099764 M01C049G20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099812 M01C049I20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099860 M01C049K20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099908 M01C049M20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099956 M01C049O20 pDONR221 MGC14-B10 BC000435 NM_001212  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040853 ARe02C05 pKA1U5 NM_001212.3  
GGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGCTGTTCGCAGTCGTTTCCGCGATGCT
HKR081608 ARf04A08 pKA1U5 NM_001212.3  
TGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCG
HKR168097 ARi20E01 pGCAP10 NM_001212.3  
GAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTC
HKR168531 ARi21F11 pGCAP10 NM_001212.3  
GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
HKR203479 ARiS008L15 pGCAP10 NM_001212.3  
GCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGT
HKR322123 RBb05F03 pKA1U5 NM_001212.3  
ATCCTGGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCG
HKR362951 RBd07G07 pGCAP10 NM_001212.3  
GGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCGT
HKR371730 RBd29F10 pGCAP10 NM_001212.3  
GGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTC
HKR383301 RBd58E05 pGCAP10 NM_001212.3  
TTGAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCNNNNTGCTGGGCTCCTC
HKR390097 RBd75E01 pGCAP10 NM_001212.3  
GGGGCAGGGGCGGGGCTTCCGGCGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGT
HKR392007 RBd80A07 pGCAP10 NM_001212.3  
GGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAG
HKR397202 RBd93A02 pGCAP10 NM_001212.3  
GGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCC
HKR398032 RBd95B08 pGCAP10 NM_001212.3  
GAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCG
HKR402926 RBdS007F06 pGCAP10 NM_001212.3  
GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
HKR406059 RBdS015C11 pGCAP10 NM_001212.3  
CGGCCGGCCGATGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl