Prev. |  KEGG KO K15414 > 

RIKEN DNA Bank Human Resource - C1QBP

Gene ID NCBI Gene 708 |  KEGG hsa:708
Gene Symbol C1QBP
Protein Name complement C1q binding protein
Synonyms COXPD33|GC1QBP|HABP1|SF2AP32|SF2p32|gC1Q-R|gC1qR|p32
Ortholog resources KEGG ortholog (KEGG orthology K15414) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008582 IRAK021H14 pCMV-SPORT6 BC013731 NM_001212 Full
HGY080447 IRAL001B23 pOTB7 BC000435 NM_001212 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099620 M01C049A20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099668 M01C049C20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099716 M01C049E20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099764 M01C049G20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099812 M01C049I20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099860 M01C049K20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099908 M01C049M20 pDONR221 MGC14-B10 BC000435 NM_001212  
HGE099956 M01C049O20 pDONR221 MGC14-B10 BC000435 NM_001212  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040853 ARe02C05 pKA1U5 NM_001212.3  
GGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGCTGTTCGCAGTCGTTTCCGCGATGCT
HKR081608 ARf04A08 pKA1U5 NM_001212.3  
TGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCG
HKR168097 ARi20E01 pGCAP10 NM_001212.3  
GAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTC
HKR168531 ARi21F11 pGCAP10 NM_001212.3  
GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
HKR203479 ARiS008L15 pGCAP10 NM_001212.3  
GCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGT
HKR322123 RBb05F03 pKA1U5 NM_001212.3  
ATCCTGGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCG
HKR362951 RBd07G07 pGCAP10 NM_001212.3  
GGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCGT
HKR371730 RBd29F10 pGCAP10 NM_001212.3  
GGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTC
HKR383301 RBd58E05 pGCAP10 NM_001212.3  
TTGAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCNNNNTGCTGGGCTCCTC
HKR390097 RBd75E01 pGCAP10 NM_001212.3  
GGGGCAGGGGCGGGGCTTCCGGCGGCGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGT
HKR392007 RBd80A07 pGCAP10 NM_001212.3  
GGCCTCAGGTCGCGGGGCGCCTAGGCCTGGGTTGTCCTTTGCATCTGCACGTGTTCGCAG
HKR397202 RBd93A02 pGCAP10 NM_001212.3  
GGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCC
HKR398032 RBd95B08 pGCAP10 NM_001212.3  
GAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCG
HKR402926 RBdS007F06 pGCAP10 NM_001212.3  
GGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGC
HKR406059 RBdS015C11 pGCAP10 NM_001212.3  
CGGCCGGCCGATGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl