Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015C11

Clone ID RBdS015C11
HP ID HP00277
Gene ID 708
Gene Symbol C1QBP
Protein Name complement component 1, q subcomponent binding protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001212.3
Length of RefSeq (bp) 1163
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.555866
5'-terminal sequence CGGCCGGCCGATGCCTTTGCATCTGCACGTGTTCGCAGTCGTTTCCGCGATGCTGCCTCT
2011.08.28