Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00265

HP ID(1) HP00265
Gene ID(2) 6228
Gene Symbol finder RPS23
Protein Name ribosomal protein S23
RefSeq NM_001025.4
Length of RefSeq (bp) 3325
Chromosome 5q14.2
Reference DDBJ accession
UniGene Hs.527193

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02B08 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe05A11 pKA1U5 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe06C04 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe07G07 pKA1U5 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
ARe11G08 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe12D08 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe16B02 pKA1U5 GCTCTTTCGCTCAGGCCCGCTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
ARe16B06 pKA1U5 TNNCTTTCNCTCAGGANCCGCTGGCGCCAACAGGATGGGCAAGTGTTCGTGAGACTTCGA
ARe22A06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe23B03 pKA1U5 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
ARe28B06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe38G05 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCNTGGTGCAAGTGTCGTGGACTTCGTAC
ARe40G08 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGACGGTTNAAGTGTCGTGGACTTCGTACT
ARe43G11 pKA1U5 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGNGCNAGATGTCGTGGACTTCGNTACTG
ARe46A10 pKA1U5 GGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGG
ARe46F01 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe49D06 pKA1U5 NNTNNGAAGACTTCTCTGTTTCGNTNNCGCCCCTGGCGCCGACNGGGTNTGCCGCAAGCT
ARe49G06 pKA1U5 GCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGCNGGCGCCGACAGGATGGGCAAGTGTCG
ARe51F06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe53D06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe54B10 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe58F10 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe60B04 pKA1U5 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
ARe60F06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe65G04 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe67G06 pKA1U5 GTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
ARe75B10 pKA1U5 ATCCTGAAGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACT
ARe77H04 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCCNGNTNCAAGTGTCGTGGACTTCGTAC
ARe82F12 pKA1U5 CTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
ARe83F12 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe88F03 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARe90D06 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARf03D01 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARf04A12 pKA1U5 GGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAA
ARf05B12 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARf07E08 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARf07G03 pKA1U5 GCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCATGGGCAAGTGTCGTGGACTTCGTA
ARi04D01 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi07A03 pGCAP10 GGTTGCTCCTTCGCCCTCGCCCCNGNCGCCAANAGNGNGGCCNANTNNCGCAGCCTTCTG
ARi07B03 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi14A08 pGCAP10 GTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTA
ARi17C08 pGCAP10 GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
ARi29B02 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi30B09 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi36C03 pGCAP10 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
ARi37H09 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi38F02 pGCAP10 GGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACGCGCAAGTGTCGTGGACTTCGTAC
ARi38G02 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi40F11 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi56E10 pGCAP10 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
ARi56G04 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi59B04 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi65F08 pGCAP10 GCTCTTTCGCTCNNNCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGNNTTCGTACTGCT
ARi66F11 pGCAP10 TCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
ARi69G10 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARi71H11 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS013E01 pGCAP10 GCTCTTTCNCTCNNNCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS020O15 pGCAP10 GTCTCTTTCNCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
ARiS023K20 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS045A12 pGCAP10 GGGCTCTTTCTCTCCCGCCCGTGNCNCCNACANGATGGGCAAGTGTCGNGNACTTCGTAC
ARiS045A17 pGCAP10
ARiS085J12 pGCAP10 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS109C12 pGCAP10 GTNTCTTTNTCTCAGGCCCNCGGCNCCCACGGGNTGGGCANGTGTCGTGGACTTCNCCCT
ARiS109O02 pGCAP10 AGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
ARiS118K01 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS161K23 pGCAP10 CGGCCGGCCGATGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTG
ARiS191N12 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS194F05 pGCAP10 GGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGG
ARiS194K17 pGCAP10 GCTCTTTCNNTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS194L19 pGCAP10 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
ARiS194M21 pGCAP10 GCTCTTTCNCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS198B17 pGCAP10
ARiS198F13 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
ARiS198G15 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb02G09 pKA1U5 TCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBb05D07 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb06A04 pKA1U5 TTTCCGGGCTTGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCC
RBb07D08 pKA1U5 TGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
RBb07F07 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb11G04 pKA1U5 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBb12B12 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb14E06 pKA1U5 GCTTTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBb15E09 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb18E10 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb19G03 pKA1U5 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb20D12 pKA1U5 GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBb23F05 pGCAP1 TTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBb25E09 pGCAP1 TGGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBb31C07 pGCAP1 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb36E10 pGCAP1 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb52B08 pGCAP1 TCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb59E09 pGCAP1 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb61D02 pGCAP1 GGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAA
RBb63G01 pGCAP1 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBb68E02 pGCAP1 CTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
RBb71H05 pGCAP1 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd03B10 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd06H06 pGCAP10 GATCCTTGGCTCCTGCCCGAGGCGCCGACCCGATGGGCCCGAGTCAGATTCTNCNATCTG
RBd11C02 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd17D12 pGCAP10 GGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTC
RBd26C12 pGCAP10 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBd28H09 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd35H10 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd37B02 pGCAP10 CCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd39B09 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd45A10 pGCAP10 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
RBd48H08 pGCAP10 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
RBd54A01 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd59B09 pGCAP10 GGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGG
RBd64E05 pGCAP10 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBd69F10 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBd87H12 pGCAP10 GCGGCGCGGAAGGGGCCCATGAGGCGTGGAGGCCGCCGAGGTCGGGGTACCGAGGGACGC
RBd98H07 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS007A12 pGCAP10 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS007D12 pGCAP10 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS007F22 pGCAP10 GCTTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
RBdS013D22 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS014E23 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS014L09 pGCAP10 GCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGT
RBdS015O04 pGCAP10 GCTTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
RBdS022K22 pGCAP10 GCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBdS022O12 pGCAP10 GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
RBdS040E04 pGCAP10 GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBdS051H19 pGCAP10 GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
RBdS051L22 pGCAP10 GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS051N04 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS075D17 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS075J06 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS104C11 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS104K06 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS110F23 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS110O22 pGCAP10 GGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAAGCTCCGTAGT
RBdS132H02 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS132L24 pGCAP10 GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
RBdS132M08 pGCAP10 GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
RBdS156J07 pGCAP10 CGGCCGGCCGATGCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGA
RBdS177B03 pGCAP10 GCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCG
RBdS177D09 pGCAP10 GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl