Prev. |  KEGG KO K02973 > 

RIKEN DNA Bank Human Resource - RPS23

Gene ID NCBI Gene 6228 |  KEGG hsa:6228
Gene Symbol RPS23
Protein Name ribosomal protein S23
Synonyms BTDD|MABAS|MCINS|PAMAS|S23|uS12
Ortholog resources KEGG ortholog (KEGG orthology K02973) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY102964 IRAL057G20 pDNR-LIB BC070221 NM_001025 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040832 ARe02B08 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR042011 ARe05A11 pKA1U5 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR042452 ARe06C04 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR042951 ARe07G07 pKA1U5 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR044552 ARe11G08 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR044880 ARe12D08 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR046426 ARe16B02 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGCTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR046430 ARe16B06 pKA1U5 NM_001025.4  
TNNCTTTCNCTCAGGANCCGCTGGCGCCAACAGGATGGGCAAGTGTTCGTGAGACTTCGA
HKR048806 ARe22A06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR049227 ARe23B03 pKA1U5 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR051230 ARe28B06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR055349 ARe38G05 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCNTGGTGCAAGTGTCGTGGACTTCGTAC
HKR056152 ARe40G08 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGACGGTTNAAGTGTCGTGGACTTCGTACT
HKR057355 ARe43G11 pKA1U5 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGNGCNAGATGTCGTGGACTTCGNTACTG
HKR058410 ARe46A10 pKA1U5 NM_001025.4  
GGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGG
HKR058521 ARe46F01 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR059678 ARe49D06 pKA1U5 NM_001025.4  
NNTNNGAAGACTTCTCTGTTTCGNTNNCGCCCCTGGCGCCGACNGGGTNTGCCGCAAGCT
HKR059750 ARe49G06 pKA1U5 NM_001025.4  
GCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGCNGGCGCCGACAGGATGGGCAAGTGTCG
HKR060526 ARe51F06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR061278 ARe53D06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR061634 ARe54B10 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR063330 ARe58F10 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR064028 ARe60B04 pKA1U5 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR064126 ARe60F06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR066148 ARe65G04 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR066950 ARe67G06 pKA1U5 NM_001025.4  
GTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR070034 ARe75B10 pKA1U5 NM_001025.4  
ATCCTGAAGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACT
HKR070972 ARe77H04 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCCNGNTNCAAGTGTCGTGGACTTCGTAC
HKR072932 ARe82F12 pKA1U5 NM_001025.4  
CTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR073332 ARe83F12 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR075323 ARe88F03 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR076078 ARe90D06 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR081273 ARf03D01 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR081612 ARf04A12 pKA1U5 NM_001025.4  
GGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAA
HKR082036 ARf05B12 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR082904 ARf07E08 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR082947 ARf07G03 pKA1U5 NM_001025.4  
GCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGCATGGGCAAGTGTCGTGGACTTCGTA
HKR161673 ARi04D01 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR162803 ARi07A03 pGCAP10 NM_001025.4  
GGTTGCTCCTTCGCCCTCGCCCCNGNCGCCAANAGNGNGGCCNANTNNCGCAGCCTTCTG
HKR162827 ARi07B03 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR165608 ARi14A08 pGCAP10 NM_001025.4  
GTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTA
HKR166856 ARi17C08 pGCAP10 NM_001025.4  
GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR171626 ARi29B02 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR172033 ARi30B09 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR174451 ARi36C03 pGCAP10 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR174977 ARi37H09 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR175322 ARi38F02 pGCAP10 NM_001025.4  
GGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACGCGCAAGTGTCGTGGACTTCGTAC
HKR175346 ARi38G02 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR176131 ARi40F11 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR182506 ARi56E10 pGCAP10 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR182548 ARi56G04 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR183628 ARi59B04 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR186128 ARi65F08 pGCAP10 NM_001025.4  
GCTCTTTCGCTCNNNCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGNNTTCGTACTGCT
HKR186531 ARi66F11 pGCAP10 NM_001025.4  
TCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR187754 ARi69G10 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR188579 ARi71H11 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR205297 ARiS013E01 pGCAP10 NM_001025.4  
GCTCTTTCNCTCNNNCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR208351 ARiS020O15 pGCAP10 NM_001025.4  
GTCTCTTTCNCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR209460 ARiS023K20 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR218012 ARiS045A12 pGCAP10 NM_001025.4  
GGGCTCTTTCTCTCCCGCCCGTGNCNCCNACANGATGGGCAAGTGTCGNGNACTTCGTAC
HKR218017 ARiS045A17 pGCAP10 NM_001025.4  
HKR234228 ARiS085J12 pGCAP10 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR243660 ARiS109C12 pGCAP10 NM_001025.4  
GTNTCTTTNTCTCAGGCCCNCGGCNCCCACGGGNTGGGCANGTGTCGTGGACTTCNCCCT
HKR243938 ARiS109O02 pGCAP10 NM_001025.4  
AGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR247441 ARiS118K01 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR264663 ARiS161K23 pGCAP10 NM_001025.4  
CGGCCGGCCGATGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTG
HKR276724 ARiS191N12 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR277725 ARiS194F05 pGCAP10 NM_001025.4  
GGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGG
HKR277857 ARiS194K17 pGCAP10 NM_001025.4  
GCTCTTTCNNTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR277883 ARiS194L19 pGCAP10 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR277909 ARiS194M21 pGCAP10 NM_001025.4  
GCTCTTTCNCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR279241 ARiS198B17 pGCAP10 NM_001025.4  
HKR279333 ARiS198F13 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR279359 ARiS198G15 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR320953 RBb02G09 pKA1U5 NM_001025.4  
TCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR322079 RBb05D07 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR322404 RBb06A04 pKA1U5 NM_001025.4  
TTTCCGGGCTTGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCC
HKR322880 RBb07D08 pKA1U5 NM_001025.4  
TGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR322927 RBb07F07 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR324548 RBb11G04 pKA1U5 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR324836 RBb12B12 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR325702 RBb14E06 pKA1U5 NM_001025.4  
GCTTTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR326105 RBb15E09 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR327306 RBb18E10 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR327747 RBb19G03 pKA1U5 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR328084 RBb20D12 pKA1U5 NM_001025.4  
GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR329325 RBb23F05 pGCAP1 NM_001025.4  
TTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR330105 RBb25E09 pGCAP1 NM_001025.4  
TGGCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR332455 RBb31C07 pGCAP1 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR334506 RBb36E10 pGCAP1 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR340832 RBb52B08 pGCAP1 NM_001025.4  
TCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR343705 RBb59E09 pGCAP1 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR344474 RBb61D02 pGCAP1 NM_001025.4  
GGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAA
HKR345345 RBb63G01 pGCAP1 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR347298 RBb68E02 pGCAP1 NM_001025.4  
CTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR348573 RBb71H05 pGCAP1 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR361234 RBd03B10 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR362574 RBd06H06 pGCAP10 NM_001025.4  
GATCCTTGGCTCCTGCCCGAGGCGCCGACCCGATGGGCCCGAGTCAGATTCTNCNATCTG
HKR364450 RBd11C02 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR366884 RBd17D12 pGCAP10 NM_001025.4  
GGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTC
HKR370460 RBd26C12 pGCAP10 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR371377 RBd28H09 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR374178 RBd35H10 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR374826 RBd37B02 pGCAP10 NM_001025.4  
CCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR375633 RBd39B09 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR378010 RBd45A10 pGCAP10 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR379376 RBd48H08 pGCAP10 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR381601 RBd54A01 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR383633 RBd59B09 pGCAP10 NM_001025.4  
GGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGG
HKR385701 RBd64E05 pGCAP10 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR387730 RBd69F10 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR394980 RBd87H12 pGCAP10 NM_001025.4  
GCGGCGCGGAAGGGGCCCATGAGGCGTGGAGGCCGCCGAGGTCGGGGTACCGAGGGACGC
HKR399375 RBd98H07 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR402812 RBdS007A12 pGCAP10 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR402884 RBdS007D12 pGCAP10 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR402942 RBdS007F22 pGCAP10 NM_001025.4  
GCTTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR405294 RBdS013D22 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR405719 RBdS014E23 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR405873 RBdS014L09 pGCAP10 NM_001025.4  
GCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGT
HKR406340 RBdS015O04 pGCAP10 NM_001025.4  
GCTTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACT
HKR409062 RBdS022K22 pGCAP10 NM_001025.4  
GCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR409148 RBdS022O12 pGCAP10 NM_001025.4  
GTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGC
HKR416100 RBdS040E04 pGCAP10 NM_001025.4  
GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR420587 RBdS051H19 pGCAP10 NM_001025.4  
GCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCT
HKR420686 RBdS051L22 pGCAP10 NM_001025.4  
GCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR420716 RBdS051N04 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR430089 RBdS075D17 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR430222 RBdS075J06 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR441659 RBdS104C11 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR441846 RBdS104K06 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR444143 RBdS110F23 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR444358 RBdS110O22 pGCAP10 NM_001025.4  
GGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAAGCTCCGTAGT
HKR452970 RBdS132H02 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR453088 RBdS132L24 pGCAP10 NM_001025.4  
GCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTG
HKR453096 RBdS132M08 pGCAP10 NM_001025.4  
GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC
HKR462623 RBdS156J07 pGCAP10 NM_001025.4  
CGGCCGGCCGATGCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGA
HKR470827 RBdS177B03 pGCAP10 NM_001025.4  
GCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCG
HKR470881 RBdS177D09 pGCAP10 NM_001025.4  
GCTCTTTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl