Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00250

HP ID(1) HP00250
Gene ID(2) 6217
Gene Symbol finder RPS16
Protein Name ribosomal protein S16
RefSeq NM_001020.4
Length of RefSeq (bp) 603
Chromosome 19q13.1
Reference DDBJ accession
UniGene Hs.397609

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03G10 pKA1U5 TGGGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCAT
ARe09C03 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARe13H08 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARe24C06 pKA1U5 TAATGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCA
ARe32B01 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGNTGTCTAGTCCACGCTCGGAGCCATGCC
ARe33H06 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTNGTTTAGTCCACGCTCGGAGCCATGCCG
ARe36A06 pKA1U5 GCTTTTCCGGTTTGCNGCGCCGCGCGGTTGAGGCCCNTCTTAGNNCCACGTCTCGGAGCC
ARe36G04 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTNTAGTCCACGCTCGGAGCCATGCCG
ARe37A02 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARe46E06 pKA1U5 CCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARe49C07 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARe56D04 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGCCNTTTANANCACGCTCGGAGCCATGCC
ARe67B11 pKA1U5 ATCCTGGCCTTTTCCGGTTGCGGCGCCGCGCGCTGAGGTTGTCTANGCCACGCTCGGAGC
ARe76A10 pKA1U5 CTTTTCCGGNTGCGGCGCCGCGCGAGNGANNCCCTTNAANANNNNCACTCGGAGCCATGC
ARe76E09 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTNTAGTCCACGCTCGGAGCCATGCCG
ARe80D01 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARe80D06 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGNTGTCTAGATCCACGCTCGGAGCCATGC
ARe84A12 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARe89D07 pKA1U5 GGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGG
ARe93A05 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARe93F11 pKA1U5 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARi03F06 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi04G01 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARi04H09 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi05D05 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi08D09 pGCAP10 GCTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARi19H07 pGCAP10 CGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
ARi23A02 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi24B09 pGCAP10 CGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
ARi27G02 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARi30H12 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi34G02 pGCAP10 GGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTGCAGGTCTT
ARi36D03 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi36E11 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARi41G11 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi44A01 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi55G08 pGCAP10 GCTTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCAT
ARi61C02 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi63C08 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARi68D12 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARiS008M15 pGCAP10 TTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
ARiS013L16 pGCAP10 AGGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATG
ARiS020G24 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARiS023H04 pGCAP10 TTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGT
ARiS085P08 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARiS088D11 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARiS109K09 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARiS118L08 pGCAP10 CGGCCGGCCGATGGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTC
ARiS161A19 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
ARiS194B15 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
ARiS194H04 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBb08D12 pKA1U5 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBb45E08 pGCAP1 GGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTG
RBb60D12 pGCAP1 TTTTGTGGTGTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGA
RBd05H07 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd16B08 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd24G06 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd32A06 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd50B05 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd53F06 pGCAP10 GCTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
RBd70C01 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBd77D06 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBd84A03 pGCAP10 GCCCTAGCTTTCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCG
RBd84H05 pGCAP10 GNCCNNGCTTTCCTTTTCCGGTTGCGGCNCCGCNCGGTGANGTTGTCTAGTCCACNCNCG
RBd95G01 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBdS007D02 pGCAP10 TGCTTTCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCC
RBdS007O20 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBdS014G22 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBdS015E12 pGCAP10 TTGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATG
RBdS051E01 pGCAP10 GGGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTG
RBdS075E07 pGCAP10 GGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCC
RBdS104J22 pGCAP10 GGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCC
RBdS132P09 pGCAP10 ATGCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
RBdS154E09 pGCAP10 GCTTTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCA
RBdS154G02 pGCAP10 GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
RBdS154M24 pGCAP10 GCTTTTCCGGTTGCGGCGCCNCNCTGTGAGGTTGTCTAGTCCACNCTCGGAGCCATGCCG
RBdS156D12 pGCAP10 GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
RBdS156K18 pGCAP10 GGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTGCA
RBdS154M21 pGCAP10 GCTTTTTCCAGTTGCGGCGCCGCGCNGTGAGGTTGTCTANTCCACGCTCGAANNCNTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl