Prev. |  KEGG KO K02960 > 

RIKEN DNA Bank Human Resource - RPS16

Gene ID NCBI Gene 6217 |  KEGG hsa:6217
Gene Symbol RPS16
Protein Name ribosomal protein S16
Synonyms S16
Ortholog resources KEGG ortholog (KEGG orthology K02960) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066733 IRAK166N21 pCMV-SPORT6 BC071674 NM_001020 Full/var
HGY085262 IRAL013C14 pOTB7 BC004324 NM_001020 Full
HGY090764 IRAL026P04 pOTB7 BC007977 NM_001020 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041354 ARe03G10 pKA1U5 NM_001020.4  
TGGGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCAT
HKR043651 ARe09C03 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR045376 ARe13H08 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR049654 ARe24C06 pKA1U5 NM_001020.4  
TAATGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCA
HKR052825 ARe32B01 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGNTGTCTAGTCCACGCTCGGAGCCATGCC
HKR053374 ARe33H06 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTNGTTTAGTCCACGCTCGGAGCCATGCCG
HKR054406 ARe36A06 pKA1U5 NM_001020.4  
GCTTTTCCGGTTTGCNGCGCCGCGCGGTTGAGGCCCNTCTTAGNNCCACGTCTCGGAGCC
HKR054548 ARe36G04 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTNTAGTCCACGCTCGGAGCCATGCCG
HKR054802 ARe37A02 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR058502 ARe46E06 pKA1U5 NM_001020.4  
CCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR059655 ARe49C07 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR062476 ARe56D04 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGCCNTTTANANCACGCTCGGAGCCATGCC
HKR066835 ARe67B11 pKA1U5 NM_001020.4  
ATCCTGGCCTTTTCCGGTTGCGGCGCCGCGCGCTGAGGTTGTCTANGCCACGCTCGGAGC
HKR070410 ARe76A10 pKA1U5 NM_001020.4  
CTTTTCCGGNTGCGGCGCCGCGCGAGNGANNCCCTTNAANANNNNCACTCGGAGCCATGC
HKR070505 ARe76E09 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTNTAGTCCACGCTCGGAGCCATGCCG
HKR072073 ARe80D01 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR072078 ARe80D06 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGNTGTCTAGATCCACGCTCGGAGCCATGC
HKR073612 ARe84A12 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR075679 ARe89D07 pKA1U5 NM_001020.4  
GGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGG
HKR077205 ARe93A05 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR077331 ARe93F11 pKA1U5 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR161326 ARi03F06 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR161745 ARi04G01 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR161777 ARi04H09 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR162077 ARi05D05 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR163281 ARi08D09 pGCAP10 NM_001020.4  
GCTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR167775 ARi19H07 pGCAP10 NM_001020.4  
CGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
HKR169202 ARi23A02 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR169633 ARi24B09 pGCAP10 NM_001020.4  
CGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
HKR170946 ARi27G02 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR172180 ARi30H12 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR173746 ARi34G02 pGCAP10 NM_001020.4  
GGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTGCAGGTCTT
HKR174475 ARi36D03 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR174507 ARi36E11 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR176555 ARi41G11 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR177601 ARi44A01 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR182152 ARi55G08 pGCAP10 NM_001020.4  
GCTTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCAT
HKR184450 ARi61C02 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR185256 ARi63C08 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR187284 ARi68D12 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR203503 ARiS008M15 pGCAP10 NM_001020.4  
TTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
HKR205480 ARiS013L16 pGCAP10 NM_001020.4  
AGGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATG
HKR208168 ARiS020G24 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR209372 ARiS023H04 pGCAP10 NM_001020.4  
TTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGT
HKR234368 ARiS085P08 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR235283 ARiS088D11 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR243849 ARiS109K09 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR247472 ARiS118L08 pGCAP10 NM_001020.4  
CGGCCGGCCGATGGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTC
HKR264419 ARiS161A19 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR277639 ARiS194B15 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR277772 ARiS194H04 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR323284 RBb08D12 pKA1U5 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR338104 RBb45E08 pGCAP1 NM_001020.4  
GGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTG
HKR344084 RBb60D12 pGCAP1 NM_001020.4  
TTTTGTGGTGTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGA
HKR362175 RBd05H07 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR366432 RBd16B08 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR369750 RBd24G06 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR372806 RBd32A06 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR380029 RBd50B05 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR381326 RBd53F06 pGCAP10 NM_001020.4  
GCTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
HKR388049 RBd70C01 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR390878 RBd77D06 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR393603 RBd84A03 pGCAP10 NM_001020.4  
GCCCTAGCTTTCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCG
HKR393773 RBd84H05 pGCAP10 NM_001020.4  
GNCCNNGCTTTCCTTTTCCGGTTGCGGCNCCGCNCGGTGANGTTGTCTAGTCCACNCNCG
HKR398145 RBd95G01 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR402874 RBdS007D02 pGCAP10 NM_001020.4  
TGCTTTCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCC
HKR403156 RBdS007O20 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR405766 RBdS014G22 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR406108 RBdS015E12 pGCAP10 NM_001020.4  
TTGCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATG
HKR420497 RBdS051E01 pGCAP10 NM_001020.4  
GGGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTG
HKR430103 RBdS075E07 pGCAP10 NM_001020.4  
GGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCC
HKR441838 RBdS104J22 pGCAP10 NM_001020.4  
GGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCC
HKR453169 RBdS132P09 pGCAP10 NM_001020.4  
ATGCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGC
HKR461705 RBdS154E09 pGCAP10 NM_001020.4  
GCTTTTTTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCA
HKR461746 RBdS154G02 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCG
HKR461909 RBdS154M21 pGCAP10 NM_001020.4  
GCTTTTTCCAGTTGCGGCGCCGCGCNGTGAGGTTGTCTANTCCACGCTCGAANNCNTGCC
HKR461912 RBdS154M24 pGCAP10 NM_001020.4  
GCTTTTCCGGTTGCGGCGCCNCNCTGTGAGGTTGTCTAGTCCACNCTCGGAGCCATGCCG
HKR462484 RBdS156D12 pGCAP10 NM_001020.4  
GCCTTTTCCGGTTGCGGCGCCGCGCGGTGAGGTTGTCTAGTCCACGCTCGGAGCCATGCC
HKR462658 RBdS156K18 pGCAP10 NM_001020.4  
GGAGGTTGTCTAGTCCACGCTCGGAGCCATGCCGTCCAAGGGCCCGCTGCAGTCTGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl