Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00242

HP ID(1) HP00242
Gene ID(2) 7919
Gene Symbol finder BAT1
Protein Name HLA-B associated transcript 1
RefSeq NM_004640.5
Length of RefSeq (bp) 2133
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.254042

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi15H07 pGCAP10 GAGTTAGATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGC
ARiS023D03 pGCAP10 GGCCGCCATACGCGCTCTCCCTGTTTAGCTCTTCTGTTAGAAATAGTATCTTTGTTTTCC
ARiS198K08 pGCAP10 GAGATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGTTATG
RBd07A11 pGCAP10 GATACGCGCTCTCCCTGTTTAGTTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGAC
RBd61D06 pGCAP10 GGGAGTAGAGGGAAGCCTGCAACCGGAAGTGAAGGCACATTTCCCTCCTTCGTCGCTGTT
RBd89A03 pGCAP10 GGGCACATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCT
RBd92F06 pGCAP10 GACATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCTCTT
RBdS154H07 pGCAP10 GGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCTCTTCTGTTAGAAATAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl