Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H07

Clone ID RBdS154H07
HP ID HP00242
Gene ID 7919
Gene Symbol BAT1
Protein Name HLA-B associated transcript 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004640.5
Length of RefSeq (bp) 2133
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.254042
5'-terminal sequence GGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCTCTTCTGTTAGAAATAGTA
2011.08.28