Prev. |  KEGG KO K12812 > 

RIKEN DNA Bank Human Resource - DDX39B

Gene ID NCBI Gene 7919 |  KEGG hsa:7919
Gene Symbol DDX39B
Protein Name DExD-box helicase 39B
Synonyms BAT1|D6S81E|UAP56
Ortholog resources KEGG ortholog (KEGG orthology K12812) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080753 IRAL001O17 pOTB7 BC000361 NM_080598 Full
HGY084304 IRAL010M16 pOTB7 BC013006 NM_080598 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166175 ARi15H07 pGCAP10 NM_004640.5  
GAGTTAGATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGC
HKR209275 ARiS023D03 pGCAP10 NM_004640.5  
GGCCGCCATACGCGCTCTCCCTGTTTAGCTCTTCTGTTAGAAATAGTATCTTTGTTTTCC
HKR279448 ARiS198K08 pGCAP10 NM_004640.5  
GAGATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGTTATG
HKR362811 RBd07A11 pGCAP10 NM_004640.5  
GATACGCGCTCTCCCTGTTTAGTTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGAC
HKR384478 RBd61D06 pGCAP10 NM_004640.5  
GGGAGTAGAGGGAAGCCTGCAACCGGAAGTGAAGGCACATTTCCCTCCTTCGTCGCTGTT
HKR395603 RBd89A03 pGCAP10 NM_004640.5  
GGGCACATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCT
HKR396926 RBd92F06 pGCAP10 NM_004640.5  
GACATTTCCCTCCTTCGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCTCTT
HKR461775 RBdS154H07 pGCAP10 NM_004640.5  
GGTCGCTGTTGCTGCCGCCATACGCGCTCTCCCTGTTTAGCTCTTCTGTTAGAAATAGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl