Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00202

HP ID(1) HP00202
Gene ID(2) 9584
Gene Symbol finder RBM39
Protein Name RNA binding motif protein 39
RefSeq NM_004902.2
Length of RefSeq (bp) 2791
Chromosome 20q11.22
Reference DDBJ accession
UniGene Hs.282901

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi40A12 pGCAP10 GAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATCCT
RBb15C02 pKA1U5 GGTGTGCTGGTGAATGTGAGTACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGA
RBb60G10 pGCAP1 GCCGCCGTCCTGCTCTCCCGCGTGGGCTTCTCTAATTCCATTGTTTTTTTTTAGATTCTC
RBd09B04 pGCAP10 GATTTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCC
RBdS051P20 pGCAP10 TGGAATGTGAGTACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGC
RBdS132O18 pGCAP10 GACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl