Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RBM39

Gene ID (NCBI) 9584
Gene Symbol RBM39
Protein Name RNA binding motif protein 39
Synonyms CAPER|CAPERalpha|FSAP59|HCC1|RNPC2
Databases KEGG hsa:9584 |  NCBI Gene 9584
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13091)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176012 ARi40A12 pGCAP10 NM_004902.2  
GAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATCCT
HKR326050 RBb15C02 pKA1U5 NM_004902.2  
GGTGTGCTGGTGAATGTGAGTACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGA
HKR344154 RBb60G10 pGCAP1 NM_004902.2  
GCCGCCGTCCTGCTCTCCCGCGTGGGCTTCTCTAATTCCATTGTTTTTTTTTAGATTCTC
HKR363628 RBd09B04 pGCAP10 NM_004902.2  
GATTTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCC
HKR420780 RBdS051P20 pGCAP10 NM_004902.2  
TGGAATGTGAGTACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGC
HKR453154 RBdS132O18 pGCAP10 NM_004902.2  
GACAGGGAAGCAGCGGCCGCCATTTCAGGGAGCTTGTCGACGCTGTCGCAGGGGTGGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl