Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00146

HP ID(1) HP00146
Gene ID(2) 3921
Gene Symbol finder RPSA
Protein Name ribosomal protein SA
RefSeq NM_002295.4
Length of RefSeq (bp) 1155
Chromosome 3p22.2
Reference DDBJ accession
UniGene Hs.449909

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07H04 pKA1U5 GGTCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
ARe21A04 pKA1U5 TGGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
ARe35F01 pKA1U5 CTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACT
ARe38B08 pKA1U5 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARe66B11 pKA1U5 GCTTTTTCCGTGCTACCTGCACAGGGGTCCATACGGCGTTGTTCNNCCATTTNCGATCGT
ARe66F01 pKA1U5 GCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGNTTGTTCTGGATTCCCGTCGTA
ARe75C01 pKA1U5 TGTTTTCCGTGCTACCTGCAGAGGGGTCCATACCGCGATTGATTCTGGATTCCCGTCGTA
ARe77F03 pKA1U5 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATNCCCTTTAAGGNTCTGGATTCCCGTCGTA
ARe81D08 pKA1U5 ATCCTGTGCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCC
ARe83E12 pKA1U5 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARi18F09 pGCAP10 TTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTT
ARi19D12 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARi20A08 pGCAP10 CTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
ARi46C12 pGCAP10 GCTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCG
ARi49E07 pGCAP10 CCTTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTC
ARi52G05 pGCAP10 GCTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCG
ARi68G02 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS023C16 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS023K24 pGCAP10 GCTTTTCCNTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS045H03 pGCAP10 GCTTTTCCGTGCTACCTGCANANGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS055P04 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS109C19 pGCAP10 GCTTTTCCNTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS191M22 pGCAP10 CTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS194D18 pGCAP10 GCTTTTCCGTGCTACCTGCANAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
ARiS198P12 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBb05C10 pKA1U5 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBb10D01 pKA1U5 GCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
RBb15E01 pKA1U5 GCCGTGCTACCTGCAGAGGGGTCCATACGGCGCTTGTTCTGGATTCCCGTCGTAACTTAA
RBb29C11 pGCAP1 TGCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
RBb58E07 pGCAP1 TGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
RBd20C04 pGCAP10 GTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBd30D09 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBd32G12 pGCAP10 TTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTT
RBd33H10 pGCAP10 GCTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGT
RBd61F03 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBd75D11 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBd92A08 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS014C02 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS014J04 pGCAP10 GGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
RBdS015E10 pGCAP10 GAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTTAAAGGGAAACTTTCAC
RBdS015M03 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS022I04 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS040F13 pGCAP10 TGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
RBdS051J24 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS110K24 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS156A18 pGCAP10 GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
RBdS177J17 pGCAP10 GCTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl