Prev. |  KEGG KO K02998 > 

RIKEN DNA Bank Human Resource - RPSA

Gene ID NCBI Gene 3921 |  KEGG hsa:3921
Gene Symbol RPSA
Protein Name ribosomal protein SA
Synonyms 37LRP|67LR|ICAS|LAMBR|LAMR1|LBP|LBP/p40|LRP|LRP/LR|NEM/1CHD4|SA|lamR|p40
Ortholog resources KEGG ortholog (KEGG orthology K02998) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007607 IRAK019A07 pCMV-SPORT6 BC013827 NM_002295 Full
HGX007917 IRAK019N05 pCMV-SPORT6 BC034537 NM_002295 Full
HGX044023 IRAK110A23 pCMV-SPORT6 BC050688 NM_002295 Full/var
HGX046035 IRAK115B11 pCMV-SPORT6 BC053370 NM_002295 Full
HGX066433 IRAK166B09 pCMV-SPORT6 BC073863 NM_002295 Full
HGX066448 IRAK166B24 pCMV-SPORT6 BC071693 NM_002295 Full
HGY066907 IRAK167E11 pBluescriptR BC066941 NM_002295 Full/var
HGY086478 IRAL016D06 pDNR-LIB BC005391 NM_002295 Full
HGY090384 IRAL025P24 pOTB7 BC010418 NM_002295 Full
HGY090651 IRAL026K11 pOTB7 BC008867 NM_002295 Full
HGY100464 IRAL051C16 pDNR-LIB BC062714 NM_002295 Full
HGY101730 IRAL054F10 pOTB7 BC068062 NM_002295 Full
HGY102812 IRAL057A12 pDNR-LIB BC070263 NM_002295 Full/var
HGY103383 IRAL058H15 pOTB7 BC071968 NM_002295 Full
HGY103526 IRAL058N14 pOTB7 BC071969 NM_002295 Full
HGY103527 IRAL058N15 pOTB7 BC071970 NM_002295 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042972 ARe07H04 pKA1U5 NM_002295.4  
GGTCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
HKR048404 ARe21A04 pKA1U5 NM_002295.4  
TGGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
HKR054121 ARe35F01 pKA1U5 NM_002295.4  
CTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACT
HKR055232 ARe38B08 pKA1U5 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR066435 ARe66B11 pKA1U5 NM_002295.4  
GCTTTTTCCGTGCTACCTGCACAGGGGTCCATACGGCGTTGTTCNNCCATTTNCGATCGT
HKR066521 ARe66F01 pKA1U5 NM_002295.4  
GCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGNTTGTTCTGGATTCCCGTCGTA
HKR070049 ARe75C01 pKA1U5 NM_002295.4  
TGTTTTCCGTGCTACCTGCAGAGGGGTCCATACCGCGATTGATTCTGGATTCCCGTCGTA
HKR070923 ARe77F03 pKA1U5 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATNCCCTTTAAGGNTCTGGATTCCCGTCGTA
HKR072480 ARe81D08 pKA1U5 NM_002295.4  
ATCCTGTGCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCC
HKR073308 ARe83E12 pKA1U5 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR167329 ARi18F09 pGCAP10 NM_002295.4  
TTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTT
HKR167684 ARi19D12 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR168008 ARi20A08 pGCAP10 NM_002295.4  
CTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
HKR178460 ARi46C12 pGCAP10 NM_002295.4  
GCTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCG
HKR179703 ARi49E07 pGCAP10 NM_002295.4  
CCTTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTC
HKR180949 ARi52G05 pGCAP10 NM_002295.4  
GCTTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCG
HKR187346 ARi68G02 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR209264 ARiS023C16 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR209464 ARiS023K24 pGCAP10 NM_002295.4  
GCTTTTCCNTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR218171 ARiS045H03 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCANANGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR222364 ARiS055P04 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR243667 ARiS109C19 pGCAP10 NM_002295.4  
GCTTTTCCNTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR276710 ARiS191M22 pGCAP10 NM_002295.4  
CTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR277690 ARiS194D18 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCANAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR279572 ARiS198P12 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR322058 RBb05C10 pKA1U5 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR324073 RBb10D01 pKA1U5 NM_002295.4  
GCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
HKR326097 RBb15E01 pKA1U5 NM_002295.4  
GCCGTGCTACCTGCAGAGGGGTCCATACGGCGCTTGTTCTGGATTCCCGTCGTAACTTAA
HKR331659 RBb29C11 pGCAP1 NM_002295.4  
TGCTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTA
HKR343303 RBb58E07 pGCAP1 NM_002295.4  
TGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
HKR368052 RBd20C04 pGCAP10 NM_002295.4  
GTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR372081 RBd30D09 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR372956 RBd32G12 pGCAP10 NM_002295.4  
TTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTT
HKR373378 RBd33H10 pGCAP10 NM_002295.4  
GCTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGT
HKR384523 RBd61F03 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR390083 RBd75D11 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR396808 RBd92A08 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR405650 RBdS014C02 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR405820 RBdS014J04 pGCAP10 NM_002295.4  
GGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
HKR406106 RBdS015E10 pGCAP10 NM_002295.4  
GAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACTTAAAGGGAAACTTTCAC
HKR406291 RBdS015M03 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR408996 RBdS022I04 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR416133 RBdS040F13 pGCAP10 NM_002295.4  
TGCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAA
HKR420640 RBdS051J24 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR444264 RBdS110K24 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR462418 RBdS156A18 pGCAP10 NM_002295.4  
GCTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAAC
HKR471033 RBdS177J17 pGCAP10 NM_002295.4  
GCTTTTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl