Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00104

HP ID(1) HP00104
Gene ID(2) 6125
Gene Symbol finder RPL5
Protein Name ribosomal protein L5
RefSeq NM_000969.3
Length of RefSeq (bp) 1035
Chromosome 1p22.1
Reference DDBJ accession
UniGene Hs.532359

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19C04 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
ARe20D05 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe21F02 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe23B02 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe24E03 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCNGGTCTCTGTCGAGCAGCGGACGCCG
ARe27F12 pKA1U5 GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe36A08 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
ARe38A05 pKA1U5 CCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
ARe39H04 pKA1U5 GGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATG
ARe40H10 pKA1U5 GGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCCGNTTGATCTCTGTCGAGCAGCGGACG
ARe44A03 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARe51B04 pKA1U5 GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
ARe68B11 pKA1U5 GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe71D09 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe74G06 pKA1U5 ATCCTGGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGG
ARe75B03 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGNTCTCTGTCGAGCAGCGGACGCC
ARe80B03 pKA1U5 TGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARe81D03 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARe95B05 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARf01F01 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARi11D01 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARi32B03 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARi32C02 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARi39A05 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARi39H07 pGCAP10 TGCCCTTTTCCCTCCCCCTAGCGCCGCTGCGACTGGGGCCCCCTGTCGAGGAAAGGCACN
ARi44G01 pGCAP10 GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARi45E06 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARi50C07 pGCAP10 GCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTG
ARi50D09 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARi51A10 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
ARi51C05 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
ARi58F02 pGCAP10 GGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTT
ARi66H07 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARiS013K17 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
ARiS020B12 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
ARiS020B14 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARiS023O01 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARiS055H23 pGCAP10 GATACTGCGCCTGCGCAAGGGCTGTGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTG
ARiS055I23 pGCAP10 GGCCTGCGCAAGGGCTGTGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCT
ARiS085E05 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARiS085H16 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARiS087M10 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARiS096P24 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
ARiS150L17 pGCAP10 GGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGC
ARiS161L01 pGCAP10 GTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTT
ARiS191B16 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
ARiS191O05 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBb03D10 pKA1U5 GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
RBb06G03 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
RBb11D12 pKA1U5 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBb12F01 pKA1U5 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBb13E08 pKA1U5 GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
RBb24F06 pGCAP1 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBb34G08 pGCAP1 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTTCGAGCAGCGGACGCC
RBb52G04 pGCAP1 TGGGTCGAGCAGCGGNACGCCGGCTCTCTGATTCCGCANGNATGGGGTTTTGTTTAAAGT
RBb56C10 pGCAP1 GTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTC
RBd03C08 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd06G11 pGCAP10 GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
RBd12F07 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd12G01 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBd18F09 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd20H02 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd25C08 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
RBd26A09 pGCAP10 GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
RBd27C07 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd48D09 pGCAP10 GGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAA
RBd50E08 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd51H07 pGCAP10 GGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGG
RBd56H02 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCNAGCAGCGGACGCCG
RBd58H04 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCNAGCAGCGGACGCCG
RBd64D03 pGCAP10 GAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGT
RBd74G10 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBd76H11 pGCAP10 GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
RBd84A09 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd84F05 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBd96H10 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd99B03 pGCAP10 GCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBd99B11 pGCAP10 GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
RBdS013A14 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS013M06 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS015J19 pGCAP10 GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBdS015K13 pGCAP10 GAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGT
RBdS015K19 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS022I14 pGCAP10 TTTTTTGGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAG
RBdS040G02 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBdS070H18 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBdS075N20 pGCAP10 GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
RBdS083K07 pGCAP10 TGGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGC
RBdS110A03 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS110H14 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS132H11 pGCAP10 GGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTTAAGA
RBdS132M10 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS154M09 pGCAP10 GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
RBdS187L12 pGCAP10 GCNTTTTCCCNCCCCCTANCNNCGNNGGCNGNGNACGNNTCCGNCGAGCNCNNNACGCCN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl