Prev. |  KEGG KO K02932 > 

RIKEN DNA Bank Human Resource - RPL5

Gene ID NCBI Gene 6125 |  KEGG hsa:6125
Gene Symbol RPL5
Protein Name ribosomal protein L5
Synonyms L5|MSTP030|PPP1R135|uL18
Ortholog resources KEGG ortholog (KEGG orthology K02932) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17329 pFLAG-CMV-5a-RPL5 Expression vector of human RPL5 tagged with FLAG at C-terminus.

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047652 ARe19C04 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
HKR048077 ARe20D05 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR048522 ARe21F02 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR049226 ARe23B02 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR049699 ARe24E03 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCNGGTCTCTGTCGAGCAGCGGACGCCG
HKR050932 ARe27F12 pKA1U5 NM_000969.3  
GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR054408 ARe36A08 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
HKR055205 ARe38A05 pKA1U5 NM_000969.3  
CCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
HKR055772 ARe39H04 pKA1U5 NM_000969.3  
GGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATG
HKR056178 ARe40H10 pKA1U5 NM_000969.3  
GGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCCGNTTGATCTCTGTCGAGCAGCGGACG
HKR057603 ARe44A03 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR060428 ARe51B04 pKA1U5 NM_000969.3  
GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
HKR067235 ARe68B11 pKA1U5 NM_000969.3  
GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR068481 ARe71D09 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR069750 ARe74G06 pKA1U5 NM_000969.3  
ATCCTGGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGG
HKR070027 ARe75B03 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGNTCTCTGTCGAGCAGCGGACGCC
HKR072027 ARe80B03 pKA1U5 NM_000969.3  
TGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR072475 ARe81D03 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR078029 ARe95B05 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR080521 ARf01F01 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR164473 ARi11D01 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR172827 ARi32B03 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR172850 ARi32C02 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR175605 ARi39A05 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR175775 ARi39H07 pGCAP10 NM_000969.3  
TGCCCTTTTCCCTCCCCCTAGCGCCGCTGCGACTGGGGCCCCCTGTCGAGGAAAGGCACN
HKR177745 ARi44G01 pGCAP10 NM_000969.3  
GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR178102 ARi45E06 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR180055 ARi50C07 pGCAP10 NM_000969.3  
GCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTG
HKR180081 ARi50D09 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR180410 ARi51A10 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR180453 ARi51C05 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR183322 ARi58F02 pGCAP10 NM_000969.3  
GGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTT
HKR186575 ARi66H07 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR205457 ARiS013K17 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR208036 ARiS020B12 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR208038 ARiS020B14 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR209537 ARiS023O01 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR222191 ARiS055H23 pGCAP10 NM_000969.3  
GATACTGCGCCTGCGCAAGGGCTGTGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTG
HKR222215 ARiS055I23 pGCAP10 NM_000969.3  
GGCCTGCGCAAGGGCTGTGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCT
HKR234101 ARiS085E05 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR234184 ARiS085H16 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR235098 ARiS087M10 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR238784 ARiS096P24 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR260281 ARiS150L17 pGCAP10 NM_000969.3  
GGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGC
HKR264665 ARiS161L01 pGCAP10 NM_000969.3  
GTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTT
HKR276440 ARiS191B16 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR276741 ARiS191O05 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR321282 RBb03D10 pKA1U5 NM_000969.3  
GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
HKR322547 RBb06G03 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGATCTCTGTCGAGCAGCGGACGCC
HKR324484 RBb11D12 pKA1U5 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR324921 RBb12F01 pKA1U5 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR325304 RBb13E08 pKA1U5 NM_000969.3  
GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
HKR329726 RBb24F06 pGCAP1 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR333752 RBb34G08 pGCAP1 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTTCGAGCAGCGGACGCC
HKR340948 RBb52G04 pGCAP1 NM_000969.3  
TGGGTCGAGCAGCGGNACGCCGGCTCTCTGATTCCGCANGNATGGGGTTTTGTTTAAAGT
HKR342458 RBb56C10 pGCAP1 NM_000969.3  
GTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTC
HKR361256 RBd03C08 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR362555 RBd06G11 pGCAP10 NM_000969.3  
GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
HKR364927 RBd12F07 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR364945 RBd12G01 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR367329 RBd18F09 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR368170 RBd20H02 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR370056 RBd25C08 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR370409 RBd26A09 pGCAP10 NM_000969.3  
GCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGG
HKR370855 RBd27C07 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR379281 RBd48D09 pGCAP10 NM_000969.3  
GGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAA
HKR380104 RBd50E08 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR380575 RBd51H07 pGCAP10 NM_000969.3  
GGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGG
HKR382570 RBd56H02 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCNAGCAGCGGACGCCG
HKR383372 RBd58H04 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCNAGCAGCGGACGCCG
HKR385675 RBd64D03 pGCAP10 NM_000969.3  
GAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGT
HKR389754 RBd74G10 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR390579 RBd76H11 pGCAP10 NM_000969.3  
GGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACG
HKR393609 RBd84A09 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR393725 RBd84F05 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR398578 RBd96H10 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR399627 RBd99B03 pGCAP10 NM_000969.3  
GCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR399635 RBd99B11 pGCAP10 NM_000969.3  
GACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTT
HKR405214 RBdS013A14 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR405494 RBdS013M06 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR406235 RBdS015J19 pGCAP10 NM_000969.3  
GCCTTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR406253 RBdS015K13 pGCAP10 NM_000969.3  
GAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGT
HKR406259 RBdS015K19 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR409006 RBdS022I14 pGCAP10 NM_000969.3  
TTTTTTGGGCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAG
HKR416146 RBdS040G02 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR428186 RBdS070H18 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR430332 RBdS075N20 pGCAP10 NM_000969.3  
GCCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCC
HKR433447 RBdS083K07 pGCAP10 NM_000969.3  
TGGCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGC
HKR444003 RBdS110A03 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR444182 RBdS110H14 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR452979 RBdS132H11 pGCAP10 NM_000969.3  
GGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTTAAGA
HKR453098 RBdS132M10 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR461897 RBdS154M09 pGCAP10 NM_000969.3  
GCCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCG
HKR475076 RBdS187L12 pGCAP10 NM_000969.3  
GCNTTTTCCCNCCCCCTANCNNCGNNGGCNGNGNACGNNTCCGNCGAGCNCNNNACGCCN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl