Prev. |  Human A to Z list >  E >  EHD1 > 

ARiS096G17 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR238561
Clone Name ARiS096G17
Clone info. Plasmid clone of human EHD1 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGGCCGGCCCCGCCTCGGCTCCGCACCCTCGCCCCGCTCTCAGCCGCCGCTCTGCCCCGC
Sequence, submitted(2) n.a.
Note There is 1 base deletion at 3086 of NM_006795.3, CDS 305-1909 (at least).
 
Sequence, refered NM_006795.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) EHD1 (NCBI Gene 10938)  other clone of EHD1 in our bank
Synonyms H-PAST|HPAST1|PAST|PAST1
Protein Name EH domain containing 1
KEGG hsa:10938
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR238561 ARiS096G17 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARiS096G17a.seq   ARiS096G17c.seq   ARiS096G17.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl