Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EHD1

Gene ID (NCBI) 10938
Gene Symbol EHD1
Protein Name EH domain containing 1
Synonyms H-PAST|HPAST1|PAST|PAST1
Databases KEGG hsa:10938 |  NCBI Gene 10938
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12483)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064483 ARe61D11 pKA1U5 NM_006795.2 done
GATTCGGCAGAGGGCGCTTCGACGGGCTGGGCNGTTTGNCTGCGCAGTGTGGGTCGCTCC
HKR238561 ARiS096G17 pGCAP10 NM_006795.2 done
GGGCCGGCCCCGCCTCGGCTCCGCACCCTCGCCCCGCTCTCAGCCGCCGCTCTGCCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl