Prev. |  KEGG KO K12483 > 

RIKEN DNA Bank Human Resource - EHD1

Gene ID NCBI Gene 10938 |  KEGG hsa:10938
Gene Symbol EHD1
Protein Name EH domain containing 1
Synonyms H-PAST|HPAST1|PAST|PAST1
Ortholog resources KEGG ortholog (KEGG orthology K12483) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064483 ARe61D11 pKA1U5 NM_006795.2 done
GATTCGGCAGAGGGCGCTTCGACGGGCTGGGCNGTTTGNCTGCGCAGTGTGGGTCGCTCC
HKR238561 ARiS096G17 pGCAP10 NM_006795.2 done
GGGCCGGCCCCGCCTCGGCTCCGCACCCTCGCCCCGCTCTCAGCCGCCGCTCTGCCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl