ARiS088J02 NRCD Human cDNA Clone

Prev. | Human A to Z list > H > HNRNPA2B1 >

ARiS088J02 - NRCD Human cDNA Clone


Catalog Number	HKR235418
Clone Name	ARiS088J02
Clone info.	Plasmid clone of human HNRPA2B1 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
Sequence, submitted⁽³⁾	n.a.
Note	3'terminus corresponds NM_001885 (CRYAB).
Sequence, refered	NM_002137.3 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	HNRNPA2B1 (NCBI Gene 3181) other clone of HNRNPA2B1 in our bank
Synonyms	HNRNPA2\|HNRNPB1\|HNRPA2\|HNRPA2B1\|HNRPB1\|IBMPFD2\|RNPA2\|SNRPB1
Protein Name	heterogeneous nuclear ribonucleoprotein A2/B1

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR235418	ARiS088J02	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARiS088J02 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR235418).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARiS088J02a.seq		ARiS088J02c.seq		ARiS088J02.pdf