Prev. |  KEGG KO K13158 > 

RIKEN DNA Bank Human Resource - HNRNPA2B1

Gene ID NCBI Gene 3181 |  KEGG hsa:3181
Gene Symbol HNRNPA2B1
Protein Name heterogeneous nuclear ribonucleoprotein A2/B1
Synonyms HNRNPA2|HNRNPB1|HNRPA2|HNRPA2B1|HNRPB1|IBMPFD2|RNPA2|SNRPB1
Ortholog resources KEGG ortholog (KEGG orthology K13158) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080572 IRAL001H04 pOTB7 BC000506 NM_002137 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063328 ARe58F08 pKA1U5 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR162078 ARi05D06 pGCAP10 NM_002137.3  
GGTAGCGGAAGACGCGTTAGTGGGGGGGAAGGTTCTAGAAAAGCGGCGGCAGCGGCTCTA
HKR172974 ARi32H06 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR177633 ARi44B09 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR181233 ARi53B09 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR186456 ARi66C08 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR186951 ARi67G07 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR187350 ARi68G06 pGCAP10 NM_002137.3  
CGGCCGGCCGATGAGGAAAAAGGTACTCTGCCAGCAGGTCACCTCATATTTAAGAATTTA
HKR187683 ARi69D11 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR205326 ARiS013F06 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR218232 ARiS045J16 pGCAP10 NM_002137.3  
GNGTCNCAGTTNNNTCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR222028 ARiS055B04 pGCAP10 NM_002137.3  
GAGTANCNGCANCGCCNGNTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR234080 ARiS085D08 pGCAP10 NM_002137.3  
GAGTAGCANCAGCGCCNGGTCCCNTGCGGAGGTGCTCCTCNCAGAGTTGTTTCTCGAGCA
HKR235418 ARiS088J02 pGCAP10 NM_002137.3 done
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR243677 ARiS109D05 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR243944 ARiS109O08 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR279325 ARiS198F05 pGCAP10 NM_002137.3  
GANTACCACCCCCCCCGGGTCCCGTGCGGAGGTGCTCNNNNNNNAGTTGTTTCTCGAGCA
HKR322879 RBb07D07 pKA1U5 NM_002137.3  
GGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAG
HKR326409 RBb16A09 pKA1U5 NM_002137.3  
TTAGAAAAGCGGCGGCAGCGGCTCTAGCGGCAGCTAGCAGCAGCGCCGGGTCCCGCTGCG
HKR328170 RBb20H02 pKA1U5 NM_002137.3  
GAGTGGGGGGGAAGGTTCTAGAAAAGCGGCGGCCCNTTNCTCTAGCGGCAGCTAGCAGCA
HKR329372 RBb23H04 pGCAP1 NM_002137.3  
GAGCGGCAGNTAGCAGCAGCGCCGGGNTCCCGATGCGGAGGNNCTNCTCGCAGAGNTTGT
HKR330083 RBb25D11 pGCAP1 NM_002137.3  
AGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCAG
HKR339236 RBb48B12 pGCAP1 NM_002137.3  
AAATGTGGAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTC
HKR361331 RBd03F11 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR366058 RBd15C10 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR368878 RBd22D06 pGCAP10 NM_002137.3  
HKR370026 RBd25B02 pGCAP10 NM_002137.3  
GAGTAGGAGCAGCGCCGGGTCCCGAGCGGAGGNGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR375235 RBd38B11 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR376449 RBd41C01 pGCAP10 NM_002137.3  
TGGAAAAAGCGGCGGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGA
HKR380404 RBd51A04 pGCAP10 NM_002137.3  
TGTCTACCATCTCCGGCGGGTCCGTTGCAGAGGTGCTCCTCTCAGAGTTGTTTCTCCAAC
HKR386574 RBd66H06 pGCAP10 NM_002137.3  
GAGTCNNNNNTCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAG
HKR388150 RBd70G06 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR393351 RBd83G07 pGCAP10 NM_002137.3  
GAGTNNNNTCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR396832 RBd92B08 pGCAP10 NM_002137.3  
GGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGA
HKR403006 RBdS007I14 pGCAP10 NM_002137.3 done
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR408909 RBdS022E13 pGCAP10 NM_002137.3  
GAGACCCGTTNNTGGGGGGGAAGGTTCNAGAAANNNNNNNNNNGCGGCTCNNNCGNCNGN
HKR420761 RBdS051P01 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR428067 RBdS070C19 pGCAP10 NM_002137.3  
CGGCCNNNNTATNANTNNNNNCNNNTNCNGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTT
HKR430323 RBdS075N11 pGCAP10 NM_002137.3  
GGAGTNCCNNCNGCGCCNGGNCCCGTGNGGAGGNGCTCCTCNCAGANTTGTTTCTCGAGC
HKR432408 RBdS081A08 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR432612 RBdS081I20 pGCAP10 NM_002137.3  
TGAGTANCNNCANCNNCGGNTCCCGTGCGGAGGTGCTCCTCNCANAGNTGTTTCTCGAGC
HKR433357 RBdS083G13 pGCAP10 NM_002137.3  
CGGCCGGNCGATGAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTT
HKR442254 RBdS105K14 pGCAP10 NM_002137.3  
GAGTANCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR444299 RBdS110M11 pGCAP10 NM_002137.3  
GAGAAAAGCGGCGGCANCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAG
HKR452865 RBdS132C17 pGCAP10 NM_002137.3  
GAGTAGCANCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR453084 RBdS132L20 pGCAP10 NM_002137.3  
GAGNNNNNNCAGCGCCGGGTCCCGTGCGGAAGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR470847 RBdS177B23 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA
HKR471032 RBdS177J16 pGCAP10 NM_002137.3  
TGGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCG
HKR471077 RBdS177L13 pGCAP10 NM_002137.3  
GGNTTNNANCANCNCCNGNTCCCGTGNGNAGGTGCTCCNNGNANAGTNGTTTCTCGAGCA
HKR475134 RBdS187N22 pGCAP10 NM_002137.3  
GAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl