Prev. |  Human A to Z list >  R >  RPS3A > 

ARi40B01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR176025
Clone Name ARi40B01
Clone info. Plasmid clone of human RPS3A cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001006.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RPS3A (NCBI Gene 6189) finder other clone of RPS3A in our bank
Synonyms FTE1|MFTL|S3A
Protein Name ribosomal protein S3A
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR176025 ARi40B01 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl