ARi38H12 NRCD Human cDNA Clone

Prev. | Human A to Z list > C > COL4A1 >

ARi38H12 - NRCD Human cDNA Clone


Catalog Number	HKR175380
Clone Name	ARi38H12
Clone info.	Plasmid clone of human COL4A1 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTT
Sequence, submitted⁽³⁾	n.a.
Note	match NM_001845.6 (1-6442), CDS:full/var (c.1257 T>C, c.4470 C>T)
Sequence, refered	NM_001845.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	COL4A1 (NCBI Gene 1282) other clone of COL4A1 in our bank
Synonyms	BSVD\|BSVD1\|COL4A1s\|PADMAL\|RATOR
Protein Name	collagen type IV alpha 1 chain

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR175380	ARi38H12	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi38H12 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR175380).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARi38H12a.seq		ARi38H12c.seq	ARi38H12z.seq	ARi38H12.pdf