Prev. |  KEGG KO K06237 > 

RIKEN DNA Bank Human Resource - COL4A1

Gene ID NCBI Gene 1282 |  KEGG hsa:1282
Gene Symbol COL4A1
Protein Name collagen type IV alpha 1 chain
Synonyms BSVD|BSVD1|PADMAL|RATOR
Ortholog resources KEGG ortholog (KEGG orthology K06237) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037310 IRAK093E14 pCMV-SPORT6 BC047305 NM_001845 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077752 ARe94G08 pKA1U5 NM_001845.4  
GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTATCGCTGGAAGTCCGGCCTT
HKR164952 ARi12G08 pGCAP10 NM_001845.4 done
GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTT
HKR166545 ARi16G01 pGCAP10 NM_001845.4  
CGGCGGCGCTCGCGCTCCCGNCCNTCACCNCTCCNNNTTCTCCCGCTNNNNNACNNNNNN
HKR175380 ARi38H12 pGCAP10 NM_001845.4 done
GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTT
HKR180897 ARi52E01 pGCAP10 NM_001845.4 done
AGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTTC
HKR184156 ARi60G12 pGCAP10 NM_001845.4 done
GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTT
HKR184850 ARi62C02 pGCAP10 NM_001845.4  
GAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTATCGCTGGAAGTCCGGCCTT
HKR187373 ARi68H05 pGCAP10 NM_001845.4  
AGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTATCGCTGGAAGTCCGGCCTTC
HKR235128 ARiS087N16 pGCAP10 NM_001845.4  
GAGGTCTCCNCTTGGAGCCNCCGCACCCGGGACGGNGCGTAGCGCTGGAAGTCCGGCCTT
HKR264508 ARiS161E12 pGCAP10 NM_001845.4  
TGTGGCCAAGACGGCCCGCCNNGCCCCCCAGGTATTCCAGGATGCAATGGCACAAAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl