Prev. |  Human A to Z list >  S >  SEMA3E > 

ARi29B12 - NRCD Human cDNA Clone

Catalog Number HKR171636
Clone Name ARi29B12
Clone info. Plasmid clone of human SEMA3E cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGTGAGATCTCAGGATGAGAGCTGCACCAACAGAGGGTGGCTAGTCCACTGTGCTGCCAA
Sequence, submitted(2) n.a.
Note Seewingly, transcript valiant (CDS segment 622-735 of NM_012431.2 is not included).
 
Sequence, refered NM_012431.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) SEMA3E (NCBI Gene 9723)  other clone of SEMA3E in our bank
Synonyms M-SEMAH|M-SemaK|SEMAH|coll-5
Protein Name semaphorin 3E
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR171636 ARi29B12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi29B12a.seq   ARi29B12c.seq   ARi29B12.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl