Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SEMA3E

Gene ID (NCBI) 9723
Gene Symbol SEMA3E
Protein Name semaphorin 3E
Synonyms M-SEMAH|M-SemaK|SEMAH|coll-5
Databases KEGG hsa:9723 |  NCBI Gene 9723
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06840)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171636 ARi29B12 pGCAP10 NM_012431.1 done
GGTGAGATCTCAGGATGAGAGCTGCACCAACAGAGGGTGGCTAGTCCACTGTGCTGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl