Prev. |  KEGG KO K06840 > 

RIKEN DNA Bank Human Resource - SEMA3E

Gene ID NCBI Gene 9723 |  KEGG hsa:9723
Gene Symbol SEMA3E
Protein Name semaphorin 3E
Synonyms M-SEMAH|M-SemaK|SEMAH|coll-5
Featured content Axon guidance - human
Ortholog resource in our bank

  SEMA3E

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171636 ARi29B12 pGCAP10 NM_012431.1 done
GGTGAGATCTCAGGATGAGAGCTGCACCAACAGAGGGTGGCTAGTCCACTGTGCTGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl