ARi11A04 NRCD Human cDNA Clone

Prev. | Human A to Z list > C > CAPN2 >

ARi11A04 - NRCD Human cDNA Clone


Catalog Number	HKR164404
Clone Name	ARi11A04
Clone info.	Plasmid clone of human CAPN2 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GCTTTCTCTGCGCAGTACGGCCGCCGGGACCGCAGCATGGCGGGCATCGCGGCCAAGCTG
Sequence, submitted⁽³⁾	n.a.
Note	match to NM_001748.5 (68-3171) CDS:full/var
Sequence, refered	NM_001748.5 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	CAPN2 (NCBI Gene 824) other clone of CAPN2 in our bank
Synonyms	CANP2\|CANPL2\|CANPml\|mCANP
Protein Name	calpain 2

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR164404	ARi11A04	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi11A04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR164404).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARi11A04a.seq		ARi11A04c.seq	ARi11A04z.seq	ARi11A04.pdf