Prev. |  KEGG KO K03853 > 

RIKEN DNA Bank Human Resource - CAPN2

Gene ID NCBI Gene 824 |  KEGG hsa:824
Gene Symbol CAPN2
Protein Name calpain 2
Synonyms CANP2|CANPL2|CANPml|mCANP
Ortholog resources KEGG ortholog (KEGG orthology K03853) in the DNA Bank
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01651 phM-Totv19 Human m-calpain large subunit cDNA
RDB02281 pAxCAhmCalpain (forward) Shuttle vector to produce rAd expressing human m-calpain
RDB02282 pAxCAhmCalpain (reverse) Shuttle vector to produce rAd expressing human m-calpain
RDB02737 AxCAhmCalpain (forward) Recombinant adenovirus harboring human m calpain cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085032 IRAL012J16 pOTB7 BC007686 NM_001748 Partial/var
HGY091315 IRAL028E19 pOTB7 BC011828 NM_001748 Partial/var
HGY095984 IRAL039P24 pOTB7 BC021303 NM_001748 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049331 ARe23F11 pKA1U5 NM_001748.4  
GGCGGCGGCGCCCGCAGTGGCCGCAGCAGCGCCCCTTNNCCTGGCCGCGCCCCAGCCNAG
HKR053602 ARe34A02 pKA1U5 NM_001748.4  
GCTCTGCGCAGTACGGCCGCCGGGTACCGCAGCATGGCGGGCATCGCGGCCAAGCTGGCG
HKR065705 ARe64E09 pKA1U5 NM_001748.4  
GTCTGCGCAGTACGGCCGCCGGGACCGCAGCATGGCGGGCATCGCGGCCAAGCTGGCGAA
HKR161773 ARi04H05 pGCAP10 NM_001748.4  
GGCGCCCCAGCCGAGCGCAGCGCGGAGTCGCCCCGACCTTTCTCTGCGCAGTACGGCCGC
HKR164404 ARi11A04 pGCAP10 NM_001748.4  
GCTTTCTCTGCGCAGTACGGCCGCCGGGACCGCAGCATGGCGGGCATCGCGGCCAAGCTG
HKR248890 ARiS122D18 pGCAP10 NM_001748.4  
GGCCTTTCTGTGGGCCAAGGAGGAGCTCAGGTGCCAGACACTCAGACTCTGATGGCTCTG
HKR260184 ARiS150H16 pGCAP10 NM_001748.4  
GAGACTCTGATGGCTCNNNNNCTAACTGGCCCATCCTCAGACTAACGCAAAGGAACGAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl