RIKEN DNA Bank Human Resource - CAPN2

Individualy Deposited Resource

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison		Status
			Refered mRNA(1)	CDS status
	5'-terminal sequence(2)
HKR049331	ARe23F11	pKA1U5	NM_001748.4
	GGCGGCGGCGCCCGCAGTGGCCGCAGCAGCGCCCCTTNNCCTGGCCGCGCCCCAGCCNAG
HKR053602	ARe34A02	pKA1U5	NM_001748.4
	GCTCTGCGCAGTACGGCCGCCGGGTACCGCAGCATGGCGGGCATCGCGGCCAAGCTGGCG
HKR161773	ARi04H05	pGCAP10	NM_001748.4
	GGCGCCCCAGCCGAGCGCAGCGCGGAGTCGCCCCGACCTTTCTCTGCGCAGTACGGCCGC
HKR248890	ARiS122D18	pGCAP10	NM_001748.4
	GGCCTTTCTGTGGGCCAAGGAGGAGCTCAGGTGCCAGACACTCAGACTCTGATGGCTCTG
HKR260184	ARiS150H16	pGCAP10	NM_001748.4
	GAGACTCTGATGGCTCNNNNNCTAACTGGCCCATCCTCAGACTAACGCAAAGGAACGAAT
HKR065705	ARe64E09	pKA1U5	NM_001748.5	full/var
	GTCTGCGCAGTACGGCCGCCGGGACCGCAGCATGGCGGGCATCGCGGCCAAGCTGGCGAA
HKR164404	ARi11A04	pGCAP10	NM_001748.5	full/var
	GCTTTCTCTGCGCAGTACGGCCGCCGGGACCGCAGCATGGCGGGCATCGCGGCCAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
    

2024.10.03