Prev. |  Human A to Z list >  R >  RAB10 > 

ARi06E02 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR162498
Clone Name ARi06E02
Clone info. Plasmid clone of human RAB10 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GAAAAGGTGGCTCTGGCCGGGGTGGCTCGGTTTCCTGGGGCTATGTAACTGAGCTCGTCG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_016131.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RAB10 (NCBI Gene 10890)  other clone of RAB10 in our bank
Synonyms -
Protein Name RAB10, member RAS oncogene family
KEGG hsa:10890
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR162498 ARi06E02 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi06E02a.seq   ARi06E02c.seq   ARi06E02.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl