Prev. |  KEGG KO K07903 > 

RIKEN DNA Bank Human Resource - RAB10

Gene ID NCBI Gene 10890 |  KEGG hsa:10890
Gene Symbol RAB10
Protein Name RAB10, member RAS oncogene family
Synonyms -
Featured content Endocytosis (human)
Featured content Rab Family - human
Ortholog resource in our bank

  RAB10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046075 ARe15D03 pKA1U5 NM_016131.3  
GACGGGGAAAAGGTGGCTCTGGCCGGGGTGGCTCGGTTTCCTGGGGCTATGTAACTGAGC
HKR162498 ARi06E02 pGCAP10 NM_016131.3 done
GAAAAGGTGGCTCTGGCCGGGGTGGCTCGGTTTCCTGGGGCTATGTAACTGAGCTCGTCG
HKR264511 ARiS161E15 pGCAP10 NM_016131.3 done
GAGGCAGCGCGCACGCCGGCGTGAGAGGGCACGGGGAAAAGGTGGCTCTGGCCGGGGTGG
HKR277601 ARiS194A01 pGCAP10 NM_016131.3 done
GAGGCAGCGCGCACGCCGGCGTGAGAGGGCACGGGGAAAAGGTGGCTCTGGCCGGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl