Prev. |  Human A to Z list >  R >  RHOG > 

ARh03F12 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR121332
Clone Name ARh03F12
Clone info. Plasmid clone of human RHOG cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GCT.CTCGAGCCCGGAGCCGCTGCCGCCGCCCCCAGCTCCCCCGCCTCGGGGAG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001665.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RHOG (NCBI Gene 391)  other clone of RHOG in our bank
Synonyms ARHG
Protein Name ras homolog family member G
KEGG hsa:391
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR121332 ARh03F12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARh03F12a.seq   ARh03F12c.seq   ARh03F12.pdf

References and tips

Featured content

Reference


2018.09.11

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl