Prev. |  KEGG KO K07863 > 

RIKEN DNA Bank Human Resource - RHOG

Gene ID NCBI Gene 391 |  KEGG hsa:391
Gene Symbol RHOG
Protein Name ras homolog family member G
Synonyms ARHG
Ortholog resource in our bank

  RHOG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR121332 ARh03F12 pGCAP1 NM_001665.3 Full done
GCT.CTCGAGCCCGGAGCCGCTGCCGCCGCCCCCAGCTCCCCCGCCTCGGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl