Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RHOG

Gene ID (NCBI) 391
Gene Symbol RHOG
Protein Name ras homolog family member G
Synonyms ARHG
Databases KEGG hsa:391 |  NCBI Gene 391
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07863)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR121332 ARh03F12 pGCAP1 NM_001665.3 done
GCT.CTCGAGCCCGGAGCCGCTGCCGCCGCCCCCAGCTCCCCCGCCTCGGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.09.11

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl