Prev. |  Human A to Z list >  R >  ROMO1 > 

ARf07H10 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR082978
Clone Name ARf07H10
Clone info. Plasmid clone of human ROMO1 cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) GGNTTTCGTGAGAGAGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGCCGT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_080748.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ROMO1 (NCBI Gene 140823) finder other clone of ROMO1 in our bank
Synonyms C20orf52|MTGM|MTGMP|bA353C18.2
Protein Name reactive oxygen species modulator 1
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR082978 ARf07H10 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl