Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47H09

Clone ID ARe47H09
HP ID HP10731
Gene ID 60626
Gene Symbol RIC8A
Protein Name resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_021932.4
Length of RefSeq (bp) 2714
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.592292
5'-terminal sequence AAAGCGCGGCCCGGAACGGCTGAGGAAGGGCCCGCTCNCGCCTTCCCCGGCGCGCCATGG
2011.08.28