Prev. | 

RIKEN DNA Bank Human Resource - RIC8A

Gene ID NCBI Gene 60626 |  KEGG hsa:60626
Gene Symbol RIC8A
Protein Name RIC8 guanine nucleotide exchange factor A
Synonyms RIC8
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091301 IRAL028E05 pOTB7 BC011821 NM_021932 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052477 ARe31D05 pKA1U5 NM_021932.4  
GAGGGCCGAGGGTGGGGAACTGCCGGGCGCGNNAGCTATGGGCATATCTGTGGCTTATTT
HKR058977 ARe47H09 pKA1U5 NM_021932.4  
AAAGCGCGGCCCGGAACGGCTGAGGAAGGGCCCGCTCNCGCCTTCCCCGGCGCGCCATGG
HKR078025 ARe95B01 pKA1U5 NM_021932.4  
GCTGGGCCAGGGCGGGGCCGGCGAACTGCGGCCCGGAACGGCTGAGGAAGGGCCCGTCCC
HKR247344 ARiS118F24 pGCAP10 NM_021932.4  
GCCCGCCTTCCCCGGCGCGCCATGGAGCCCCGGGCGGTTGCAGAAGCCGTGGAGACGGGT
HKR462429 RBdS156B05 pGCAP10 NM_021932.4  
GCCCNCTTCCCCGGCGCGCCATGGAGCCCCGGGCGGTTGCAGAAGCCGTGGAGACGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl