Prev. |  Human A to Z list >   >   > 

ARe17H05 - NRCD Human cDNA Clone

Catalog Number HKR046973
Clone Name ARe17H05
Clone info. Plasmid clone of human FGF2 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) ATCCTGGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGC
Sequence, submitted(3) n.a.
Note match to NM_002006.6 (128-4028) CDS:parcial/var
 
Sequence, refered NM_002006.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4)  (NCBI Gene 2247)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR046973 ARe17H05 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe17H05a.seq   ARe17H05c.seq ARe17H05z.seq ARe17H05.pdf

References and tips

Featured content

Reference

user_report Horigome, T., Sulfated glycosaminoglycans and non-classically secreted proteins, basic FGF and epimorphin, coordinately regulate TGF-beta-induced cell behaviors of human scar dermal fibroblasts. J. Dermatol. Sci. 86 (2): 132-141 (2017). PMID 28209294.

2022.06.08

NRCDhumcloneList_AR_2022Apr03.csv - DataSheet_NRCD_html_210920.pl