DNA Bank Top |  KEGG KO K18497 > 

RIKEN DNA Bank Human Resource - FGF2

Gene ID NCBI Gene 2247 |  KEGG hsa:2247
Gene Symbol FGF2
Protein Name fibroblast growth factor 2
Synonyms BFGF|FGF-2|FGFB|HBGF-2
Featured content Signaling pathways regulating pluripotency of stem cells (human)

Link

Ortholog resource in our bank

  FGF2


External database

human FGF2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB01339 pF35B 2.5 Human basic FGF genomic DNA Exon 3    
RDB01338 pF25BS 5.0 Human basic FGF genomic DNA 3' region of exon 3    
RDB01337 pF25BS 8.6 Human basic FGF genomic DNA Exon 3    
RDB01336 pF9HS 7.5 Human basic FGF genomic DNA Intron 2    
RDB01335 pF9H 2.6 Human basic FGF genomic DNA Exon 2    
RDB01334 pF17S 11 Human basic FGF genomic DNA Exon 1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053649 ARe34C01 pKA1U5 NM_001361665.2 full done
GGCCAGATTAGCGGACGCGGTGCCCGCGGATTGCNANTNGAATCCCGGGCGCTGCAGCTT
HKR060855 ARe52C07 pKA1U5 NM_002006.4  
GGCCAGAATTANCGCACTCGGTNGCCCTCGGCTTGCCACTTGNAATCCCGGGCGCTGCAG
HKR169727 ARi24F07 pGCAP10 NM_002006.4  
GGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCNGTGCGCTGCAGCTTGG
HKR170947 ARi27G03 pGCAP10 NM_002006.6 pacial done
GAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAG
HKR046973 ARe17H05 pKA1U5 NM_002006.6 parcial/var done
ATCCTGGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl