Prev. | Human A to Z list > F > 

RIKEN DNA Bank Human Resource - FGF2

Gene ID (NCBI) 2247
Gene Symbol FGF2
Protein Name fibroblast growth factor 2
Synonyms BFGF|FGF-2|FGFB|HBGF-2
Databases KEGG hsa:2247 |  NCBI Gene 2247
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18497)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01334 pF17S 11 Human basic FGF genomic DNA Exon 1
RDB01335 pF9H 2.6 Human basic FGF genomic DNA Exon 2
RDB01336 pF9HS 7.5 Human basic FGF genomic DNA Intron 2
RDB01337 pF25BS 8.6 Human basic FGF genomic DNA Exon 3
RDB01338 pF25BS 5.0 Human basic FGF genomic DNA 3' region of exon 3
RDB01339 pF35B 2.5 Human basic FGF genomic DNA Exon 3

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046973 ARe17H05 pKA1U5 NM_002006.4  
ATCCTGGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGC
HKR053649 ARe34C01 pKA1U5 NM_002006.4  
GGCCAGATTAGCGGACGCGGTGCCCGCGGATTGCNANTNGAATCCCGGGCGCTGCAGCTT
HKR060855 ARe52C07 pKA1U5 NM_002006.4  
GGCCAGAATTANCGCACTCGGTNGCCCTCGGCTTGCCACTTGNAATCCCGGGCGCTGCAG
HKR169727 ARi24F07 pGCAP10 NM_002006.4  
GGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCNGTGCGCTGCAGCTTGG
HKR170947 ARi27G03 pGCAP10 NM_002006.4  
GAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl