ARe15G03 NRCD Human cDNA Clone

Prev. | Human A to Z list > A > ACOT8 >

ARe15G03 - NRCD Human cDNA Clone


Catalog Number	HKR046147
Clone Name	ARe15G03
Clone info.	Plasmid clone of human ACOT8 cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	GGCCGGAAGAGTCAGGTTCTGTGTATGTCTCCNCGTTCTTCCGCGGAGCGGGTGTGCAGG
Sequence, submitted⁽³⁾	n.a.
Note	match to NM_005469.4 (1-1154) CDS:full
Sequence, refered	NM_005469.2 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	ACOT8 (NCBI Gene 10005) other clone of ACOT8 in our bank
Synonyms	HNAACTE\|NAP1\|PTE-1\|PTE-2\|PTE1\|PTE2\|hACTE-III\|hTE
Protein Name	acyl-CoA thioesterase 8

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR046147	ARe15G03	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe15G03 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR046147).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARe15G03a.seq		ARe15G03c.seq	ARe15G03z.seq	ARe15G03.pdf