Prev. |  Human A to Z list >   >   > 

ARe15G03 - NRCD Human cDNA Clone

Catalog Number HKR046147
Clone Name ARe15G03
Clone info. Plasmid clone of human ACOT8 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGCCGGAAGAGTCAGGTTCTGTGTATGTCTCCNCGTTCTTCCGCGGAGCGGGTGTGCAGG
Sequence, submitted(2) n.a.
Note match to NM_005469.4 (1-1154) CDS:full
 
Sequence, refered NM_005469.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 10005)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR046147 ARe15G03 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe15G03a.seq   ARe15G03c.seq ARe15G03z.seq ARe15G03.pdf

References and tips

Featured content

Reference


2021.06.04

NRCDhumcloneList_AR_210404.csv - DataSheet_NRCD_html_200831.pl